GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-08-12 02:31:46, GGGenome : Marmoset pre-spliced RNA, RefSeq on calJac4, D3G 22.02 (Feb, 2022)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

XM_035293093.1|ZGRF1;100413039|chr3:83276494:83375131:+|prespliced::chr3:83276494-83375131(+)
position: 73575-73589
ATATGAAAATTCAATAAAAGTACATTACAA73575AATGTTGTCAATGAAATTGTAATTATTTTTCAGACTATGACATTA
XM_035293094.1|ZGRF1;100413039|chr3:83276494:83375131:+|prespliced::chr3:83276494-83375131(+)
position: 73575-73589
ATATGAAAATTCAATAAAAGTACATTACAA73575AATGTTGTCAATGAAATTGTAATTATTTTTCAGACTATGACATTA
XM_035293095.1|ZGRF1;100413039|chr3:83276494:83375131:+|prespliced::chr3:83276494-83375131(+)
position: 73575-73589
ATATGAAAATTCAATAAAAGTACATTACAA73575AATGTTGTCAATGAAATTGTAATTATTTTTCAGACTATGACATTA
XM_035293096.1|ZGRF1;100413039|chr3:83276494:83375131:+|prespliced::chr3:83276494-83375131(+)
position: 73575-73589
ATATGAAAATTCAATAAAAGTACATTACAA73575AATGTTGTCAATGAAATTGTAATTATTTTTCAGACTATGACATTA
XM_035293097.1|ZGRF1;100413039|chr3:83276494:83375131:+|prespliced::chr3:83276494-83375131(+)
position: 73575-73589
ATATGAAAATTCAATAAAAGTACATTACAA73575AATGTTGTCAATGAAATTGTAATTATTTTTCAGACTATGACATTA
XM_035293098.1|ZGRF1;100413039|chr3:83276494:83375131:+|prespliced::chr3:83276494-83375131(+)
position: 73575-73589
ATATGAAAATTCAATAAAAGTACATTACAA73575AATGTTGTCAATGAAATTGTAATTATTTTTCAGACTATGACATTA
XM_035293100.1|ZGRF1;100413039|chr3:83276494:83375131:+|prespliced::chr3:83276494-83375131(+)
position: 73575-73589
ATATGAAAATTCAATAAAAGTACATTACAA73575AATGTTGTCAATGAAATTGTAATTATTTTTCAGACTATGACATTA
XM_035293101.1|ZGRF1;100413039|chr3:83276494:83375131:+|prespliced::chr3:83276494-83375131(+)
position: 73575-73589
ATATGAAAATTCAATAAAAGTACATTACAA73575AATGTTGTCAATGAAATTGTAATTATTTTTCAGACTATGACATTA
XM_035293099.1|ZGRF1;100413039|chr3:83276494:83376318:+|prespliced::chr3:83276494-83376318(+)
position: 73575-73589
ATATGAAAATTCAATAAAAGTACATTACAA73575AATGTTGTCAATGAAATTGTAATTATTTTTCAGACTATGACATTA
XR_004741452.1|LOC118152724;118152724|chr4:235824:255793:+|prespliced::chr4:235824-255793(+)
position: 1561-1575
TTGGCTCACGTTTCTCTTTTGGGTGGTGTT1561AATGTTGTCAATGAAAAGAGTCAAACTCTGTAAAATATTTGAAAG
XM_035296255.1|TBX18;100412573|chr4:86892169:87049275:-|prespliced::chr4:86892169-87049275(-)
position: 70712-70726
TTTAGGTTTTATGTAGTTTTCAGATTGTAT70712AATGTTGTCAATGAATTCAAGTAAAAACAAACTTCAAATGAGACA
XR_004741912.1|TBX18;100412573|chr4:86892169:87049275:-|prespliced::chr4:86892169-87049275(-)
position: 70712-70726
TTTAGGTTTTATGTAGTTTTCAGATTGTAT70712AATGTTGTCAATGAATTCAAGTAAAAACAAACTTCAAATGAGACA
XR_004743512.1|CEP112;100385578|chr5:121877148:122390643:+|prespliced::chr5:121877148-122390643(+)
position: 400405-400419
AAATGCTTCCAGCTTTTACCCATTCAGCAT400405AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
XM_035301595.1|CEP112;100385578|chr5:121877150:122513070:+|prespliced::chr5:121877150-122513070(+)
position: 400403-400417
AAATGCTTCCAGCTTTTACCCATTCAGCAT400403AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
XM_035301594.1|CEP112;100385578|chr5:121877151:122513070:+|prespliced::chr5:121877151-122513070(+)
position: 400402-400416
AAATGCTTCCAGCTTTTACCCATTCAGCAT400402AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
XM_035301600.1|CEP112;100385578|chr5:121877151:122513070:+|prespliced::chr5:121877151-122513070(+)
position: 400402-400416
AAATGCTTCCAGCTTTTACCCATTCAGCAT400402AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
XR_004743510.1|CEP112;100385578|chr5:121877151:122590856:+|prespliced::chr5:121877151-122590856(+)
position: 400402-400416
AAATGCTTCCAGCTTTTACCCATTCAGCAT400402AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
XR_004743511.1|CEP112;100385578|chr5:121877152:122590856:+|prespliced::chr5:121877152-122590856(+)
position: 400401-400415
AAATGCTTCCAGCTTTTACCCATTCAGCAT400401AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
XM_035301601.1|CEP112;100385578|chr5:121877153:122513070:+|prespliced::chr5:121877153-122513070(+)
position: 400400-400414
AAATGCTTCCAGCTTTTACCCATTCAGCAT400400AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
XM_035301602.1|CEP112;100385578|chr5:121877153:122513070:+|prespliced::chr5:121877153-122513070(+)
position: 400400-400414
AAATGCTTCCAGCTTTTACCCATTCAGCAT400400AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
XM_008997624.2|CEP112;100385578|chr5:121877700:122513070:+|prespliced::chr5:121877700-122513070(+)
position: 399853-399867
AAATGCTTCCAGCTTTTACCCATTCAGCAT399853AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
XM_035301603.1|CEP112;100385578|chr5:121877700:122513070:+|prespliced::chr5:121877700-122513070(+)
position: 399853-399867
AAATGCTTCCAGCTTTTACCCATTCAGCAT399853AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
XM_035301597.1|CEP112;100385578|chr5:121877859:122513070:+|prespliced::chr5:121877859-122513070(+)
position: 399694-399708
AAATGCTTCCAGCTTTTACCCATTCAGCAT399694AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
XM_035301598.1|CEP112;100385578|chr5:121877859:122513070:+|prespliced::chr5:121877859-122513070(+)
position: 399694-399708
AAATGCTTCCAGCTTTTACCCATTCAGCAT399694AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
XM_008997625.3|CEP112;100385578|chr5:121877860:122513070:+|prespliced::chr5:121877860-122513070(+)
position: 399693-399707
AAATGCTTCCAGCTTTTACCCATTCAGCAT399693AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
XM_035301596.1|CEP112;100385578|chr5:121878193:122513070:+|prespliced::chr5:121878193-122513070(+)
position: 399360-399374
AAATGCTTCCAGCTTTTACCCATTCAGCAT399360AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
XM_035301599.1|CEP112;100385578|chr5:121878193:122513070:+|prespliced::chr5:121878193-122513070(+)
position: 399360-399374
AAATGCTTCCAGCTTTTACCCATTCAGCAT399360AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
XM_035301604.1|CEP112;100385578|chr5:121888143:122513070:+|prespliced::chr5:121888143-122513070(+)
position: 389410-389424
AAATGCTTCCAGCTTTTACCCATTCAGCAT389410AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
XM_035301607.1|CEP112;100385578|chr5:121901588:122513070:+|prespliced::chr5:121901588-122513070(+)
position: 375965-375979
AAATGCTTCCAGCTTTTACCCATTCAGCAT375965AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
XM_035301606.1|CEP112;100385578|chr5:121902786:122513070:+|prespliced::chr5:121902786-122513070(+)
position: 374767-374781
AAATGCTTCCAGCTTTTACCCATTCAGCAT374767AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
XM_008998816.3|RBMS1;100400884|chr6:67097339:67313795:+|prespliced::chr6:67097339-67313795(+)
position: 120132-120146
AAGTTCCAAAGTAAATTTGCATTATATGCT120132AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
XM_017973436.2|RBMS1;100400884|chr6:67097339:67313795:+|prespliced::chr6:67097339-67313795(+)
position: 120132-120146
AAGTTCCAAAGTAAATTTGCATTATATGCT120132AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
XM_017973437.2|RBMS1;100400884|chr6:67097339:67313795:+|prespliced::chr6:67097339-67313795(+)
position: 120132-120146
AAGTTCCAAAGTAAATTTGCATTATATGCT120132AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
XM_017973441.2|RBMS1;100400884|chr6:67097339:67313795:+|prespliced::chr6:67097339-67313795(+)
position: 120132-120146
AAGTTCCAAAGTAAATTTGCATTATATGCT120132AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
XM_017973442.2|RBMS1;100400884|chr6:67097339:67313795:+|prespliced::chr6:67097339-67313795(+)
position: 120132-120146
AAGTTCCAAAGTAAATTTGCATTATATGCT120132AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
XM_017973443.3|RBMS1;100400884|chr6:67121124:67313795:+|prespliced::chr6:67121124-67313795(+)
position: 96347-96361
AAGTTCCAAAGTAAATTTGCATTATATGCT96347AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
XM_017973438.2|RBMS1;100400884|chr6:67176583:67313795:+|prespliced::chr6:67176583-67313795(+)
position: 40888-40902
AAGTTCCAAAGTAAATTTGCATTATATGCT40888AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
XM_017973440.2|RBMS1;100400884|chr6:67176583:67313795:+|prespliced::chr6:67176583-67313795(+)
position: 40888-40902
AAGTTCCAAAGTAAATTTGCATTATATGCT40888AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
XM_035304708.1|RBMS1;100400884|chr6:67176583:67313795:+|prespliced::chr6:67176583-67313795(+)
position: 40888-40902
AAGTTCCAAAGTAAATTTGCATTATATGCT40888AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
XM_035257261.1|MGAT4C;100413583|chr9:91969793:92892192:+|prespliced::chr9:91969793-92892192(+)
position: 250528-250542
AACCCTCTCCTGTAGAATTTCTTTCCATGA250528AATGTTGTCAATGAAAAAGAATGAAAAGTCATGTAGATTCATGTA
XM_035257262.1|MGAT4C;100413583|chr9:91969793:92892192:+|prespliced::chr9:91969793-92892192(+)
position: 250528-250542
AACCCTCTCCTGTAGAATTTCTTTCCATGA250528AATGTTGTCAATGAAAAAGAATGAAAAGTCATGTAGATTCATGTA
XM_035257223.1|MGAT4C;100413583|chr9:91969795:92892192:+|prespliced::chr9:91969795-92892192(+)
position: 250526-250540
AACCCTCTCCTGTAGAATTTCTTTCCATGA250526AATGTTGTCAATGAAAAAGAATGAAAAGTCATGTAGATTCATGTA
XM_035257224.1|MGAT4C;100413583|chr9:91969795:92892192:+|prespliced::chr9:91969795-92892192(+)
position: 250526-250540
AACCCTCTCCTGTAGAATTTCTTTCCATGA250526AATGTTGTCAATGAAAAAGAATGAAAAGTCATGTAGATTCATGTA
XM_035257225.1|MGAT4C;100413583|chr9:91969795:92892192:+|prespliced::chr9:91969795-92892192(+)
position: 250526-250540
AACCCTCTCCTGTAGAATTTCTTTCCATGA250526AATGTTGTCAATGAAAAAGAATGAAAAGTCATGTAGATTCATGTA
XM_035257226.1|MGAT4C;100413583|chr9:91969795:92892192:+|prespliced::chr9:91969795-92892192(+)
position: 250526-250540
AACCCTCTCCTGTAGAATTTCTTTCCATGA250526AATGTTGTCAATGAAAAAGAATGAAAAGTCATGTAGATTCATGTA
XM_035257230.1|MGAT4C;100413583|chr9:91969795:92892192:+|prespliced::chr9:91969795-92892192(+)
position: 250526-250540
AACCCTCTCCTGTAGAATTTCTTTCCATGA250526AATGTTGTCAATGAAAAAGAATGAAAAGTCATGTAGATTCATGTA
XM_035257231.1|MGAT4C;100413583|chr9:91969795:92892192:+|prespliced::chr9:91969795-92892192(+)
position: 250526-250540
AACCCTCTCCTGTAGAATTTCTTTCCATGA250526AATGTTGTCAATGAAAAAGAATGAAAAGTCATGTAGATTCATGTA
XM_035257242.1|MGAT4C;100413583|chr9:91969795:92892192:+|prespliced::chr9:91969795-92892192(+)
position: 250526-250540
AACCCTCTCCTGTAGAATTTCTTTCCATGA250526AATGTTGTCAATGAAAAAGAATGAAAAGTCATGTAGATTCATGTA
XM_035257244.1|MGAT4C;100413583|chr9:91969795:92892192:+|prespliced::chr9:91969795-92892192(+)
position: 250526-250540
AACCCTCTCCTGTAGAATTTCTTTCCATGA250526AATGTTGTCAATGAAAAAGAATGAAAAGTCATGTAGATTCATGTA
XM_035257245.1|MGAT4C;100413583|chr9:91969795:92892192:+|prespliced::chr9:91969795-92892192(+)
position: 250526-250540
AACCCTCTCCTGTAGAATTTCTTTCCATGA250526AATGTTGTCAATGAAAAAGAATGAAAAGTCATGTAGATTCATGTA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/calJac4_RefSeq_prespliced_d3g2202/AATGTTGTCAATGAA
lang : en | db : calJac4_RefSeq_prespliced_d3g2202 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.086 | 0.078 | search_plus_done; http://172.18.8.78:28901/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.122 | 0.036 | search_minus_done; http://172.18.8.78:28901/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=0
0.122 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).