GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 10:53:49, GGGenome : Marmoset pre-spliced RNA, TRaC 20.03 on calJacRKC1912, D3G 20.03 (Mar, 2020)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

ENSCJAG00000002275;TRaC2003L0325a|DNAAF4-CCPG1|chr10:34702178:34761900:-|prespliced
position: 37041-37055
TATGTTAAACTTGTCCAAGATATTTTTAGT37041TTCATTGACAACATTTTTCATTTTAAAAGTTCTGGGTTTTTTTTC
ENSCJAG00000002275;TRaC2003L0325b|DNAAF4-CCPG1|chr10:34702370:34761900:-|prespliced
position: 37041-37055
TATGTTAAACTTGTCCAAGATATTTTTAGT37041TTCATTGACAACATTTTTCATTTTAAAAGTTCTGGGTTTTTTTTC
ENSCJAG00000002275;TRaC2003L0325c|DNAAF4-CCPG1|chr10:34702699:34761900:-|prespliced
position: 37041-37055
TATGTTAAACTTGTCCAAGATATTTTTAGT37041TTCATTGACAACATTTTTCATTTTAAAAGTTCTGGGTTTTTTTTC
ENSCJAG00000002275;TRaC2003L0325d|DNAAF4-CCPG1|chr10:34702724:34761900:-|prespliced
position: 37041-37055
TATGTTAAACTTGTCCAAGATATTTTTAGT37041TTCATTGACAACATTTTTCATTTTAAAAGTTCTGGGTTTTTTTTC
ENSCJAG00000002275;TRaC2003L0325e|DNAAF4-CCPG1|chr10:34702775:34761900:-|prespliced
position: 37041-37055
TATGTTAAACTTGTCCAAGATATTTTTAGT37041TTCATTGACAACATTTTTCATTTTAAAAGTTCTGGGTTTTTTTTC
ENSCJAG00000002275;TRaC2003L0325f|DNAAF4-CCPG1|chr10:34709547:34761900:-|prespliced
position: 37041-37055
TATGTTAAACTTGTCCAAGATATTTTTAGT37041TTCATTGACAACATTTTTCATTTTAAAAGTTCTGGGTTTTTTTTC
ENSCJAG00000002275;TRaC2003L03260|DNAAF4-CCPG1|chr10:34719158:34761900:-|prespliced
position: 37041-37055
TATGTTAAACTTGTCCAAGATATTTTTAGT37041TTCATTGACAACATTTTTCATTTTAAAAGTTCTGGGTTTTTTTTC
ENSCJAG00000015526;TRaC2003L0e86c|RPS6KC1|chr19:37424547:37760690:+|prespliced
position: 224945-224959
GCATACGGAGAAACTGGATAGCAAAATAAA224945TTCATTGACAACATTTCCAACAAAACTAGGTGACAAACCATGAAT
ENSCJAG00000018706;TRaC2003L101aa|SDK1|chr2:183998511:184698229:+|prespliced
position: 254735-254749
GTGGTGCCTGGCCTGAGTCAGCACATTAGC254735TTCATTGACAACATTGGTTCATTCAACAAATAATTGCCTGAGAAG
ENSCJAG00000018706;TRaC2003L101ab|SDK1|chr2:183998511:184716587:+|prespliced
position: 254735-254749
GTGGTGCCTGGCCTGAGTCAGCACATTAGC254735TTCATTGACAACATTGGTTCATTCAACAAATAATTGCCTGAGAAG
ENSCJAG00000018706;TRaC2003L101ac|SDK1|chr2:183998511:184957975:+|prespliced
position: 254735-254749
GTGGTGCCTGGCCTGAGTCAGCACATTAGC254735TTCATTGACAACATTGGTTCATTCAACAAATAATTGCCTGAGAAG
ENSCJAG00000003740;TRaC2003L140d9|ZGRF1|chr3:79974568:80073025:+|prespliced
position: 73475-73489
ATATGAAAATTCAATAAAAGTACATTACAA73475AATGTTGTCAATGAAATTGTAATTATTTTTCAGACTATGACATTA
na;TRaC2003L16bc4|na|chr4:167341671:167365233:-|prespliced
position: 1610-1624
TTGGCTCACGTTTCTCTTTTGGGTGGTGTT1610AATGTTGTCAATGAAAAGAGTCAAACTCTGTAAAATATTTGAAAG
ENSCJAG00000000300;TRaC2003L177e4|CEP112|chr5:41761827:42498494:-|prespliced
position: 399774-399788
AAATGCTTCCAGCTTTTACCCATTCAGCAT399774AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
ENSCJAG00000000300;TRaC2003L177e5|CEP112|chr5:41761827:42498494:-|prespliced
position: 399774-399788
AAATGCTTCCAGCTTTTACCCATTCAGCAT399774AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
ENSCJAG00000000300;TRaC2003L177e6|CEP112|chr5:41761910:42498494:-|prespliced
position: 399774-399788
AAATGCTTCCAGCTTTTACCCATTCAGCAT399774AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
ENSCJAG00000000300;TRaC2003L177ed|CEP112|chr5:41869517:42498494:-|prespliced
position: 399774-399788
AAATGCTTCCAGCTTTTACCCATTCAGCAT399774AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
ENSCJAG00000000300;TRaC2003L177ee|CEP112|chr5:41869517:42498494:-|prespliced
position: 399774-399788
AAATGCTTCCAGCTTTTACCCATTCAGCAT399774AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
ENSCJAG00000000300;TRaC2003L177ef|CEP112|chr5:41869746:42347156:-|prespliced
position: 248436-248450
AAATGCTTCCAGCTTTTACCCATTCAGCAT248436AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
ENSCJAG00000000300;TRaC2003L177f1|CEP112|chr5:41869749:42498494:-|prespliced
position: 399774-399788
AAATGCTTCCAGCTTTTACCCATTCAGCAT399774AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
ENSCJAG00000000300;TRaC2003L177f2|CEP112|chr5:41869749:42498494:-|prespliced
position: 399774-399788
AAATGCTTCCAGCTTTTACCCATTCAGCAT399774AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
ENSCJAG00000000300;TRaC2003L177f3|CEP112|chr5:41870918:42170041:-|prespliced
position: 71321-71335
AAATGCTTCCAGCTTTTACCCATTCAGCAT71321AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
ENSCJAG00000000300;TRaC2003L177f4|CEP112|chr5:41870918:42242300:-|prespliced
position: 143580-143594
AAATGCTTCCAGCTTTTACCCATTCAGCAT143580AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
ENSCJAG00000000300;TRaC2003L177f5|CEP112|chr5:41991829:42498494:-|prespliced
position: 399774-399788
AAATGCTTCCAGCTTTTACCCATTCAGCAT399774AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
ENSCJAG00000014861;TRaC2003L1a834|RBMS1|chr6:92469844:92686106:-|prespliced
position: 119928-119942
AAGTTCCAAAGTAAATTTGCATTATATGCT119928AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
ENSCJAG00000037955;TRaC2003L1a835|RBMS1|chr6:92469844:92686106:-|prespliced
position: 119928-119942
AAGTTCCAAAGTAAATTTGCATTATATGCT119928AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
ENSCJAG00000037955;TRaC2003L1a836|MIR4785|chr6:92469844:92607037:-|prespliced
position: 40859-40873
AAGTTCCAAAGTAAATTTGCATTATATGCT40859AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
ENSCJAG00000014861;TRaC2003L1a837|RBMS1|chr6:92469941:92606985:-|prespliced
position: 40807-40821
AAGTTCCAAAGTAAATTTGCATTATATGCT40807AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
ENSCJAG00000014861;TRaC2003L1a838|RBMS1|chr6:92469941:92686106:-|prespliced
position: 119928-119942
AAGTTCCAAAGTAAATTTGCATTATATGCT119928AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
ENSCJAG00000014861;TRaC2003L1a839|MIR4785|chr6:92469941:92607037:-|prespliced
position: 40859-40873
AAGTTCCAAAGTAAATTTGCATTATATGCT40859AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
ENSCJAG00000014861;TRaC2003L1a83a|RBMS1|chr6:92471537:92686106:-|prespliced
position: 119928-119942
AAGTTCCAAAGTAAATTTGCATTATATGCT119928AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
ENSCJAG00000014861;TRaC2003L1a83b|MIR4785|chr6:92471563:92607037:-|prespliced
position: 40859-40873
AAGTTCCAAAGTAAATTTGCATTATATGCT40859AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
ENSCJAG00000014861;TRaC2003L1a83c|RBMS1|chr6:92471569:92607037:-|prespliced
position: 40859-40873
AAGTTCCAAAGTAAATTTGCATTATATGCT40859AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
ENSCJAG00000014861;TRaC2003L1a83d|MIR4785|chr6:92472317:92607037:-|prespliced
position: 40859-40873
AAGTTCCAAAGTAAATTTGCATTATATGCT40859AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
ENSCJAG00000014861;TRaC2003L1a83e|RBMS1|chr6:92472317:92686106:-|prespliced
position: 119928-119942
AAGTTCCAAAGTAAATTTGCATTATATGCT119928AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
ENSCJAG00000014861;TRaC2003L1a83f|RBMS1|chr6:92472360:92614629:-|prespliced
position: 48451-48465
AAGTTCCAAAGTAAATTTGCATTATATGCT48451AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
ENSCJAG00000014861;TRaC2003L1a840|MIR4785|chr6:92472360:92607037:-|prespliced
position: 40859-40873
AAGTTCCAAAGTAAATTTGCATTATATGCT40859AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
ENSCJAG00000014861;TRaC2003L1a841|RBMS1|chr6:92472373:92686106:-|prespliced
position: 119928-119942
AAGTTCCAAAGTAAATTTGCATTATATGCT119928AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
ENSCJAG00000014861;TRaC2003L1a842|RBMS1|chr6:92472382:92686269:-|prespliced
position: 120091-120105
AAGTTCCAAAGTAAATTTGCATTATATGCT120091AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
ENSCJAG00000014861;TRaC2003L1a843|RBMS1|chr6:92472394:92686106:-|prespliced
position: 119928-119942
AAGTTCCAAAGTAAATTTGCATTATATGCT119928AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
ENSCJAG00000014861;TRaC2003L1a844|RBMS1|chr6:92478873:92685795:-|prespliced
position: 119617-119631
AAGTTCCAAAGTAAATTTGCATTATATGCT119617AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
ENSCJAG00000014861;TRaC2003L1a845|MIR4785|chr6:92479688:92607037:-|prespliced
position: 40859-40873
AAGTTCCAAAGTAAATTTGCATTATATGCT40859AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
ENSCJAG00000014861;TRaC2003L1a846|RBMS1|chr6:92479700:92686106:-|prespliced
position: 119928-119942
AAGTTCCAAAGTAAATTTGCATTATATGCT119928AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
ENSCJAG00000014861;TRaC2003L1a847|RBMS1|chr6:92479729:92685795:-|prespliced
position: 119617-119631
AAGTTCCAAAGTAAATTTGCATTATATGCT119617AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
ENSCJAG00000014861;TRaC2003L1a848|MIR4785|chr6:92482256:92607037:-|prespliced
position: 40859-40873
AAGTTCCAAAGTAAATTTGCATTATATGCT40859AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
ENSCJAG00000014861;TRaC2003L1a849|MIR4785|chr6:92485674:92607037:-|prespliced
position: 40859-40873
AAGTTCCAAAGTAAATTTGCATTATATGCT40859AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
ENSCJAG00000014861;TRaC2003L1a84a|RBMS1|chr6:92516400:92686106:-|prespliced
position: 119928-119942
AAGTTCCAAAGTAAATTTGCATTATATGCT119928AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
ENSCJAG00000014861;TRaC2003L1a84b|MIR4785|chr6:92541779:92607037:-|prespliced
position: 40859-40873
AAGTTCCAAAGTAAATTTGCATTATATGCT40859AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
ENSCJAG00000014861;TRaC2003L1a84c|RBMS1|chr6:92557172:92686106:-|prespliced
position: 119928-119942
AAGTTCCAAAGTAAATTTGCATTATATGCT119928AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
ENSCJAG00000019762;TRaC2003L1f442|MGAT4C|chr9:41009862:41920426:-|prespliced
position: 244003-244017
AACCCTCTCCTGTAGAATTTCTTTCCATGA244003AATGTTGTCAATGAAAAAGAATGAAAAGTCATGTAGATTCATGTA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/calJacRKC1912_Trac2003_prespliced_d3g2003/TTCATTGACAACATT
lang : en | db : calJacRKC1912_Trac2003_prespliced_d3g2003 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.091 | 0.084 | search_plus_done; http://172.18.8.75:28811/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.115 | 0.025 | search_minus_done; http://172.18.8.75:28811/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=39
0.139 | 0.023 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).