GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-05 13:13:07, GGGenome : Marmoset pre-spliced RNA, TRaC 21.01 on calJacRKC1912, D3G 21.01 (Jan, 2021)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

TRaC2101L038d8;ENSCJAG00000002275|DNAAF4-CCPG1|chr10:34702178:34761900:-|prespliced::chr10:34702178-34761900(-)
position: 37041-37055
TATGTTAAACTTGTCCAAGATATTTTTAGT37041TTCATTGACAACATTTTTCATTTTAAAAGTTCTGGGTTTTTTTTC
TRaC2101L038d9;ENSCJAG00000002275|DNAAF4-CCPG1|chr10:34702370:34761900:-|prespliced::chr10:34702370-34761900(-)
position: 37041-37055
TATGTTAAACTTGTCCAAGATATTTTTAGT37041TTCATTGACAACATTTTTCATTTTAAAAGTTCTGGGTTTTTTTTC
TRaC2101L038da;ENSCJAG00000002275|DNAAF4-CCPG1|chr10:34702699:34761900:-|prespliced::chr10:34702699-34761900(-)
position: 37041-37055
TATGTTAAACTTGTCCAAGATATTTTTAGT37041TTCATTGACAACATTTTTCATTTTAAAAGTTCTGGGTTTTTTTTC
TRaC2101L038db;ENSCJAG00000002275|DNAAF4-CCPG1|chr10:34702699:34761900:-|prespliced::chr10:34702699-34761900(-)
position: 37041-37055
TATGTTAAACTTGTCCAAGATATTTTTAGT37041TTCATTGACAACATTTTTCATTTTAAAAGTTCTGGGTTTTTTTTC
TRaC2101L038dc;ENSCJAG00000002275|DNAAF4-CCPG1|chr10:34702724:34761900:-|prespliced::chr10:34702724-34761900(-)
position: 37041-37055
TATGTTAAACTTGTCCAAGATATTTTTAGT37041TTCATTGACAACATTTTTCATTTTAAAAGTTCTGGGTTTTTTTTC
TRaC2101L038dd;ENSCJAG00000002275|DNAAF4-CCPG1|chr10:34709547:34761900:-|prespliced::chr10:34709547-34761900(-)
position: 37041-37055
TATGTTAAACTTGTCCAAGATATTTTTAGT37041TTCATTGACAACATTTTTCATTTTAAAAGTTCTGGGTTTTTTTTC
TRaC2101L038de;ENSCJAG00000002275|DNAAF4-CCPG1|chr10:34719158:34761900:-|prespliced::chr10:34719158-34761900(-)
position: 37041-37055
TATGTTAAACTTGTCCAAGATATTTTTAGT37041TTCATTGACAACATTTTTCATTTTAAAAGTTCTGGGTTTTTTTTC
TRaC2101L10a59;ENSCJAG00000015526|RPS6KC1|chr19:37424547:37760690:+|prespliced::chr19:37424547-37760690(+)
position: 224945-224959
GCATACGGAGAAACTGGATAGCAAAATAAA224945TTCATTGACAACATTTCCAACAAAACTAGGTGACAAACCATGAAT
TRaC2101L127ea;ENSCJAG00000018706|SDK1|chr2:183998511:184698250:+|prespliced::chr2:183998511-184698250(+)
position: 254735-254749
GTGGTGCCTGGCCTGAGTCAGCACATTAGC254735TTCATTGACAACATTGGTTCATTCAACAAATAATTGCCTGAGAAG
TRaC2101L127ed;ENSCJAG00000018706|SDK1|chr2:183998511:184831186:+|prespliced::chr2:183998511-184831186(+)
position: 254735-254749
GTGGTGCCTGGCCTGAGTCAGCACATTAGC254735TTCATTGACAACATTGGTTCATTCAACAAATAATTGCCTGAGAAG
TRaC2101L127ee;ENSCJAG00000018706|SDK1|chr2:183998511:184917271:+|prespliced::chr2:183998511-184917271(+)
position: 254735-254749
GTGGTGCCTGGCCTGAGTCAGCACATTAGC254735TTCATTGACAACATTGGTTCATTCAACAAATAATTGCCTGAGAAG
TRaC2101L127ec;ENSCJAG00000018706|SDK1|chr2:183998511:184716587:+|prespliced::chr2:183998511-184716587(+)
position: 254735-254749
GTGGTGCCTGGCCTGAGTCAGCACATTAGC254735TTCATTGACAACATTGGTTCATTCAACAAATAATTGCCTGAGAAG
TRaC2101L16f4d;ENSCJAG00000003740|ZGRF1|chr3:79974568:80082259:+|prespliced::chr3:79974568-80082259(+)
position: 73475-73489
ATATGAAAATTCAATAAAAGTACATTACAA73475AATGTTGTCAATGAAATTGTAATTATTTTTCAGACTATGACATTA
TRaC2101L16f4e;ENSCJAG00000003740|ZGRF1|chr3:79974568:80072995:+|prespliced::chr3:79974568-80072995(+)
position: 73475-73489
ATATGAAAATTCAATAAAAGTACATTACAA73475AATGTTGTCAATGAAATTGTAATTATTTTTCAGACTATGACATTA
TRaC2101L16f49;ENSCJAG00000003740|ZGRF1|chr3:79974568:80071669:+|prespliced::chr3:79974568-80071669(+)
position: 73475-73489
ATATGAAAATTCAATAAAAGTACATTACAA73475AATGTTGTCAATGAAATTGTAATTATTTTTCAGACTATGACATTA
TRaC2101L16f4f;ENSCJAG00000003740|ZGRF1|chr3:79974592:80082259:+|prespliced::chr3:79974592-80082259(+)
position: 73451-73465
ATATGAAAATTCAATAAAAGTACATTACAA73451AATGTTGTCAATGAAATTGTAATTATTTTTCAGACTATGACATTA
TRaC2101L1a104;na|na|chr4:167361179:167365268:-|prespliced::chr4:167361179-167365268(-)
position: 1645-1659
TTGGCTCACGTTTCTCTTTTGGGTGGTGTT1645AATGTTGTCAATGAAAAGAGTCAAACTCTGTAAAATATTTGAAAG
TRaC2101L1af0d;ENSCJAG00000000300|CEP112|chr5:41869517:42498512:-|prespliced::chr5:41869517-42498512(-)
position: 399792-399806
AAATGCTTCCAGCTTTTACCCATTCAGCAT399792AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
TRaC2101L1af0c;ENSCJAG00000000300|CEP112|chr5:41869517:42498512:-|prespliced::chr5:41869517-42498512(-)
position: 399792-399806
AAATGCTTCCAGCTTTTACCCATTCAGCAT399792AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
TRaC2101L1af0f;ENSCJAG00000000300|CEP112|chr5:41869749:42498512:-|prespliced::chr5:41869749-42498512(-)
position: 399792-399806
AAATGCTTCCAGCTTTTACCCATTCAGCAT399792AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
TRaC2101L1af10;ENSCJAG00000000300|CEP112|chr5:41869749:42498512:-|prespliced::chr5:41869749-42498512(-)
position: 399792-399806
AAATGCTTCCAGCTTTTACCCATTCAGCAT399792AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
TRaC2101L1af11;ENSCJAG00000000300|CEP112|chr5:41870918:42347154:-|prespliced::chr5:41870918-42347154(-)
position: 248434-248448
AAATGCTTCCAGCTTTTACCCATTCAGCAT248434AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
TRaC2101L1af13;ENSCJAG00000000300|CEP112|chr5:41991785:42488092:-|prespliced::chr5:41991785-42488092(-)
position: 389372-389386
AAATGCTTCCAGCTTTTACCCATTCAGCAT389372AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
TRaC2101L1af12;ENSCJAG00000000300|CEP112|chr5:41991785:42498512:-|prespliced::chr5:41991785-42498512(-)
position: 399792-399806
AAATGCTTCCAGCTTTTACCCATTCAGCAT399792AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
TRaC2101L1af14;ENSCJAG00000000300|CEP112|chr5:41991785:42498512:-|prespliced::chr5:41991785-42498512(-)
position: 399792-399806
AAATGCTTCCAGCTTTTACCCATTCAGCAT399792AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
TRaC2101L1af15;ENSCJAG00000000300|CEP112|chr5:41991822:42498512:-|prespliced::chr5:41991822-42498512(-)
position: 399792-399806
AAATGCTTCCAGCTTTTACCCATTCAGCAT399792AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
TRaC2101L1e598;ENSCJAG00000037955|RBMS1|chr6:92469844:92685795:-|prespliced::chr6:92469844-92685795(-)
position: 119617-119631
AAGTTCCAAAGTAAATTTGCATTATATGCT119617AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
TRaC2101L1e597;ENSCJAG00000037955|RBMS1|chr6:92469844:92606985:-|prespliced::chr6:92469844-92606985(-)
position: 40807-40821
AAGTTCCAAAGTAAATTTGCATTATATGCT40807AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
TRaC2101L1e596;ENSCJAG00000037955|RBMS1|chr6:92469844:92686106:-|prespliced::chr6:92469844-92686106(-)
position: 119928-119942
AAGTTCCAAAGTAAATTTGCATTATATGCT119928AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
TRaC2101L1e599;ENSCJAG00000014861|RBMS1|chr6:92469941:92685795:-|prespliced::chr6:92469941-92685795(-)
position: 119617-119631
AAGTTCCAAAGTAAATTTGCATTATATGCT119617AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
TRaC2101L1e59a;ENSCJAG00000014861|RBMS1|chr6:92471563:92686106:-|prespliced::chr6:92471563-92686106(-)
position: 119928-119942
AAGTTCCAAAGTAAATTTGCATTATATGCT119928AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
TRaC2101L1e59b;ENSCJAG00000014861|RBMS1|chr6:92472373:92606985:-|prespliced::chr6:92472373-92606985(-)
position: 40807-40821
AAGTTCCAAAGTAAATTTGCATTATATGCT40807AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
TRaC2101L1e59c;ENSCJAG00000014861|RBMS1|chr6:92472374:92606985:-|prespliced::chr6:92472374-92606985(-)
position: 40807-40821
AAGTTCCAAAGTAAATTTGCATTATATGCT40807AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
TRaC2101L1e59d;ENSCJAG00000014861|RBMS1|chr6:92472379:92606985:-|prespliced::chr6:92472379-92606985(-)
position: 40807-40821
AAGTTCCAAAGTAAATTTGCATTATATGCT40807AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
TRaC2101L1e59e;ENSCJAG00000014861|RBMS1|chr6:92479723:92686106:-|prespliced::chr6:92479723-92686106(-)
position: 119928-119942
AAGTTCCAAAGTAAATTTGCATTATATGCT119928AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
TRaC2101L1e59f;ENSCJAG00000014861|RBMS1|chr6:92481027:92606985:-|prespliced::chr6:92481027-92606985(-)
position: 40807-40821
AAGTTCCAAAGTAAATTTGCATTATATGCT40807AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
TRaC2101L1e5a0;ENSCJAG00000014861|RBMS1|chr6:92499450:92685795:-|prespliced::chr6:92499450-92685795(-)
position: 119617-119631
AAGTTCCAAAGTAAATTTGCATTATATGCT119617AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
TRaC2101L1e5a1;ENSCJAG00000014861|RBMS1|chr6:92511109:92686106:-|prespliced::chr6:92511109-92686106(-)
position: 119928-119942
AAGTTCCAAAGTAAATTTGCATTATATGCT119928AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
TRaC2101L1e5a3;ENSCJAG00000014861|RBMS1|chr6:92512773:92686106:-|prespliced::chr6:92512773-92686106(-)
position: 119928-119942
AAGTTCCAAAGTAAATTTGCATTATATGCT119928AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
TRaC2101L1e5a2;ENSCJAG00000014861|RBMS1|chr6:92512773:92606985:-|prespliced::chr6:92512773-92606985(-)
position: 40807-40821
AAGTTCCAAAGTAAATTTGCATTATATGCT40807AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
TRaC2101L1e5a4;ENSCJAG00000014861|RBMS1|chr6:92516423:92606985:-|prespliced::chr6:92516423-92606985(-)
position: 40807-40821
AAGTTCCAAAGTAAATTTGCATTATATGCT40807AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
TRaC2101L1e5a5;ENSCJAG00000014861|RBMS1|chr6:92541779:92686106:-|prespliced::chr6:92541779-92686106(-)
position: 119928-119942
AAGTTCCAAAGTAAATTTGCATTATATGCT119928AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
TRaC2101L1e5a6;ENSCJAG00000014861|RBMS1|chr6:92548603:92606985:-|prespliced::chr6:92548603-92606985(-)
position: 40807-40821
AAGTTCCAAAGTAAATTTGCATTATATGCT40807AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
TRaC2101L23d6c;ENSCJAG00000019762|MGAT4C|chr9:41009862:41920426:-|prespliced::chr9:41009862-41920426(-)
position: 244003-244017
AACCCTCTCCTGTAGAATTTCTTTCCATGA244003AATGTTGTCAATGAAAAAGAATGAAAAGTCATGTAGATTCATGTA
TRaC2101L23d72;na|MGAT4C|chr9:41642857:42019991:-|prespliced::chr9:41642857-42019991(-)
position: 343568-343582
AACCCTCTCCTGTAGAATTTCTTTCCATGA343568AATGTTGTCAATGAAAAAGAATGAAAAGTCATGTAGATTCATGTA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/calJacRKC1912_Trac2101_prespliced_d3g2101/TTCATTGACAACATT
lang : en | db : calJacRKC1912_Trac2101_prespliced_d3g2101 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.080 | 0.072 | search_plus_done; http://172.18.8.75:28852/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.097 | 0.017 | search_minus_done; http://172.18.8.75:28852/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=38
0.118 | 0.021 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).