GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-09-28 21:43:19, GGGenome : Guinea pig genome, Broad/cavPor3 (Feb, 2008)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold_2:4943338-4943352
AGTAAATTTTGCTAGCCACCTACATCAGTC4943338TTCATTGACAACATTGTACGAATTTGTGAGGACCTCTGGAAACAC
scaffold_9:16384707-16384721
TGTGAGAGACTTTAAAACATTGACTTGCAA16384707TTCATTGACAACATTTGTAAATCTTTGATTCAAATATTTTAACAT
scaffold_18:1453300-1453314
GTTTGATTCTAATTGATAAAAGTGTTACTC1453300TTCATTGACAACATTTTATGTTTTTTTTTAAATGGGTCAATACTC
scaffold_22:7279758-7279772
ACTTCCCTGCCTGTATGTGTTCCAGTGGTT7279758TTCATTGACAACATTGTAAAGGTTCTAATACTGTTTCAGCTCACT
scaffold_32:10374307-10374321
GGAGGCTCATCCCATCCCCAAAAAGAAAAA10374307TTCATTGACAACATTTTATTATCTTGAGTGTTGTGTACATTTGAT
scaffold_34:14204570-14204584
TTATTTTTTCATTCTAGATAACTTCTTTAG14204570TTCATTGACAACATTCCTTAAATTTGATAAGACATCCCCCTTTTC
scaffold_36:10453778-10453792
TATCAACTTGAGATTGCAGTTCACCAGCCT10453778TTCATTGACAACATTGTATTACTTTCTCCCCTGGCCCTCTTCTCT
scaffold_158:1547520-1547534
CTCTTTGAATCTCATCAGCCTCCACCATGA1547520TTCATTGACAACATTGTTTTTCCTTTTTTAGCTGAAGATAGAAGG
scaffold_1:9772507-9772521
GGGTAAAATTGAGATTCAGTAAATATTTAT9772507AATGTTGTCAATGAAATAATTTCCTTAAATGCTTGCCTTTGATTG
scaffold_5:14517407-14517421
CTTAGGAAAATGTTCTCCTGCTCCTCGCTA14517407AATGTTGTCAATGAAGTATCCTGTCATTGTCAATGAAGACTTTTT
scaffold_6:57850114-57850128
GTAAGAATGAATCTGAGACAATTTTGACAT57850114AATGTTGTCAATGAATAATTCAGTCATGACCTGGGCCCTGATTTT
scaffold_58:6436167-6436181
ATATTACATCACTTCTTCTTTTACTATGTA6436167AATGTTGTCAATGAACTTCATAGCATATGAGCATATTATTGTATG
scaffold_73:4628727-4628741
TGGCACCTACGCTAGAATCAAAATGTACAG4628727AATGTTGTCAATGAAGAAAATTCACAGACTTGATAGAAGTCTGAC
scaffold_126:2870624-2870638
ATCATTATGTTGACCACCATAGATTTATAT2870624AATGTTGTCAATGAAAATTGCTTTCCTTATTGACCTGTGTTGATG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/cavPor3/TTCATTGACAACATT
lang : en | db : cavPor3 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.100 | 0.093 | search_plus_done; http://172.18.8.78:28036/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.106 | 0.005 | search_minus_done; http://172.18.8.78:28036/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=42
0.107 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).