GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-04-15 19:03:46, GGGenome : Green monkey genome, Chlorocebus_sabeus 1.1/chlSab2 (Mar, 2014)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr4:9292900-9292914
GAGGGCCTTTCCAGCTCCAAGGTCAATGGC9292900AATGTTGTCAATGAAAGATCAGCAGGTCAGTGCCTTATACCCAGA
chr11:74684012-74684026
GTATGATAAGTTTGTTCCAGAAGTTTAAAA74684012AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
chr18:3425610-3425624
ACTATGCGAGCAATGGGGAGTCTCATTTTC3425610AATGTTGTCAATGAAATGAATAATTGTTATAATCTCTCCTAAAAC
chr22:18519661-18519675
GCCTGTTTTTCATATGCATATGTAATAGGG18519661AATGTTGTCAATGAAAACACAATAGTATTTGGAGTGCAGCATAGT
chr25:24979355-24979369
TCATAATGTGTAAAATTCCTAATGTGAGGG24979355AATGTTGTCAATGAAAAATACTTAGCATTGTTGACACACAAGGAC
chr3:63217385-63217399
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA63217385TTCATTGACAACATTGCCTGAGGTAACTCACACTGAGGTGACAAC
chr4:43351105-43351119
TTAAGTCTTATTAACTTAAATTGCTATTAA43351105TTCATTGACAACATTAATAACTGTATAACAAACTATGCAAGCTTT
chr7:14043245-14043259
CTTAAATCACGATCAATGTCATGTCACAGT14043245TTCATTGACAACATTTCTTCCTTTTTAGCAGTATATAAAATAGTG
chr7:95403518-95403532
CAGAATATATTATCACTTTGAACACAGATT95403518TTCATTGACAACATTTTGTGGGCATCCATTTAATATTAATATTAA
chr7:112164397-112164411
TAAAACCTCTGATTTTGTGTAACACTCCTT112164397TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGACTACAT
chr7:127465226-127465240
TTTGGACCCCCAGATCAGTCTTCATATTCT127465226TTCATTGACAACATTCATGAAGTTCTGCAGAAGTTAAATAGAATT
chr9:32040642-32040656
GTTAAATGCCTCTATTCTAATTTCTGGTAG32040642TTCATTGACAACATTTGGTGTTCCTTGGCTTGGAGATGCATCACT
chr13:81143559-81143573
TACCAGCTTTTGCTTTATTTTAATAACAGT81143559TTCATTGACAACATTGGCTTCTAAAATTGTGTAGAAATATTAACT
chr16:13438276-13438290
GCCTCTGGGCCTGTGTTAGATGGGCCATGC13438276TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
chr27:29161092-29161106
TTCTCTCAACAAAGTAGATATCGATAAATA29161092TTCATTGACAACATTTGAATTTTGTGTTTCCCAAGAGCTGTGGGA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/chlSab2/AATGTTGTCAATGAA
lang : en | db : chlSab2 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.235 | 0.228 | search_plus_done; http://172.18.8.78:28763/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.242 | 0.007 | search_minus_done; http://172.18.8.78:28763/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=45
0.244 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).