GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-03-03 01:35:55, GGGenome : Sloth genome, Broad/choHof1 (Jul, 2008)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold_1272:31456-31470
TAGAATGTATTATCGCTTCAAACACAGATT31456TTCATTGACAACATTTTGTGGGCATCCATTTAATATTAATATTAA
scaffold_15314:12722-12736
GATCCTCAGCAGCTTTGGTGTAACATGCAC12722TTCATTGACAACATTTAAGGATTTAAACAAGCAGGGATGAAGAAA
scaffold_22307:6099-6113
TTCTGTGCCACATGTCCATGATCAGTGTTA6099TTCATTGACAACATTTTGTGGGGCTTAAGGTCCTTACTGTGGAGC
scaffold_41504:3619-3633
GTGCCACATGTCTGTGATCATTAAGTGTTG3619TTCATTGACAACATTTTGTGGGGCTTACGGTCCTTACTGTGGAGC
scaffold_416:33518-33532
GAACAGTGGAAACGAGCTATGGATTATTTA33518AATGTTGTCAATGAACTCAACTATATGACTCAGATTGTTATCATG
scaffold_35095:12013-12027
AGCAAAAGTTTCTAAATCTTGTGATTTTTA12013AATGTTGTCAATGAATTCAAATGTGAAGCTTTGTGAGGACTAAAT
scaffold_36905:9169-9183
ATTACAAACAGTAGATCAAACAAGGTTTTC9169AATGTTGTCAATGAATAGGAAGCTGATTTAGCTTCCATGTTATGT
scaffold_42978:6319-6333
ATGTGCCCTTCAGGTTTTCAATAAATTCTT6319AATGTTGTCAATGAAAATGTCACTGCTAAAAAGATTTAAATCCCA
scaffold_47959:10142-10156
TGTGTTCCCAAAGATGGGGAGGGAGTTTGG10142AATGTTGTCAATGAAGTTTAGTATTCACCTGATGTTTTTTGCCGT
scaffold_64055:403-417
TGCTTTGAAGAAGGGAAGAGGCTCAGAGAG403AATGTTGTCAATGAAGACAAACTCCTGATGGGTGGACATTGCATT
scaffold_66275:911-925
AAGAAGGTATAAAAACTAAATCTACAGATC911AATGTTGTCAATGAATATTAATTTATATAAAAGTTCTAAACAAAA
scaffold_133578:845-859
CTTGAAAATAATCTCAGTGATACACCTCTG845AATGTTGTCAATGAAAACAAGAATTAAATTCACTATAACAGAAAG
scaffold_138235:370-384
ACAGTTCTTTGATTTCCTTTCAATACTCCA370AATGTTGTCAATGAACTGATTTTTCACAAAACAGTCTTAATTATG
scaffold_147042:3868-3882
GAACAGTGGAAACGAGCTATGGATTATTTA3868AATGTTGTCAATGAACTCAACTATATGACTCAGATTGTTATCATG
scaffold_150445:1278-1292
TGTGTTCCCAAAGATGGGGAGGGAGTTTGG1278AATGTTGTCAATGAAGTTTAGTATTCACCTGATGTTTTTTGCCGT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/choHof1/TTCATTGACAACATT
lang : en | db : choHof1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.122 | 0.115 | search_plus_done; http://172.18.8.77:28060/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.128 | 0.006 | search_minus_done; http://172.18.8.77:28060/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=46
0.130 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).