GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 11:25:12, GGGenome : Painted turtle genome, v3.0.1/chrPic1 (Dec, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

JH584449:10174267-10174281
ACTTGTCTATGTAACCTTTAAAAATCTTCC10174267TTCATTGACAACATTCTCATTTGATCTTATCTGTTTCAAGACTGG
JH584488:256385-256399
GCTATCCGTGGAATGAATAACTGCAAACAA256385TTCATTGACAACATTTTTGCTCTACTTCCTTCTGCATCAGTAAAA
JH584535:8861005-8861019
ATAGAAAAAGTCTTCCTAATTACATATTCC8861005TTCATTGACAACATTGTCTCCAACCGTGAAAGATGGATGAGAGTT
JH584568:941472-941486
GAAGCTGTAGGATTTATGGTAAACAGAGTT941472TTCATTGACAACATTGGTGATGGATTAATTTAAAGCAGGAAACTA
JH584613:2379542-2379556
ATGGAATGAGAATATAGAAAGGAGTAACAC2379542TTCATTGACAACATTAGCTTCTATATGCCTCCATAAGACTTGTTT
JH584734:2400367-2400381
TGGACTAGAGCTGGCTGGAGGAAAATTCCA2400367TTCATTGACAACATTTGAGATTTTGAAATTTATTTATAAAAACAA
JH584826:1954127-1954141
GGCTTTGGATCAGGCCCTAAAATCTGCTCC1954127TTCATTGACAACATTATACTATAGCCCCTTTTCAGCAGAATACGT
JH584853:1406894-1406908
AATCAGAGATCAAGTCATACATGATGCTGG1406894TTCATTGACAACATTCATCAAAGCCAAGATGGTGCTATCACAGCA
JH584500:1126814-1126828
ATACTGCAAAACTTTTCCAGGGGTAGTCTC1126814AATGTTGTCAATGAATTAGCTTCAGCCATGTGCTCAGTTCTCATG
JH584517:1752225-1752239
GGGGTCACTGCCTCTAATGCATGTGTCGAG1752225AATGTTGTCAATGAAAACCCTCCTGGTGGCCAGATCAATAGACCC
JH584632:970057-970071
TTTTTTCAGTCAGTGTTCAGGCCAACTCCC970057AATGTTGTCAATGAAGTTTTAGCCCCAGTAAGGACAAATAGATTA
JH584680:4976941-4976955
AAAGTTCAGCTGCAGTGATGACAACGTATT4976941AATGTTGTCAATGAAGCACCCATTCCCTGACACAAATGCCGGAGA
JH584813:2750134-2750148
CTGTACAAAGCAATGGTTGTTTAAAGAGAC2750134AATGTTGTCAATGAAATTCCAAGCAATTCTGGCTCAAGAAGTGCT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/chrPic1/TTCATTGACAACATT
lang : en | db : chrPic1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.084 | 0.078 | search_plus_done; http://172.18.8.76:28081/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.096 | 0.011 | search_minus_done; http://172.18.8.76:28081/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=42
0.097 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).