GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-09-17 00:54:33, GGGenome : Chinese hamster genome, C_griseus_v1.0/criGri1 (Jul, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

KE380273:3073747-3073761
ACTCAATAAGAATGTATTGAATATCTATTA3073747TTCATTGACAACATTCTAGGAAGGAGATCTATAAGTCACTAGCAA
KE380942:363052-363066
GTTTAAAAACAACATCACCTATTTCTTGGT363052TTCATTGACAACATTGGTATTCCAAGGATTAATAATCTTTCTTGG
KE377625:1168-1182
CAAGCTCCTATTTTAGTGTTCTTGCTGAAC1168AATGTTGTCAATGAATGTTGGTTTTGATATGTACCATATGCTAGA
KE380761:261991-262005
TGACATGGCTTAGTTGGAAGGTAATTTCAA261991AATGTTGTCAATGAATATCTGTTAATATACTCAGTTATTGAAGTA
KE381516:1178093-1178107
CTTTGCAGAAAAGATTTCCTAACAAAATGT1178093AATGTTGTCAATGAAACTCATCAAATAGGCCAGCATTAGATCATT
KE381979:285312-285326
AGCTATGATAAGAATTTAAAGTATACTCAC285312AATGTTGTCAATGAAATATAAGAATAGAATGAAAAAGTAGGAAAC
KE382227:2654641-2654655
TGCCAATATCTTGACTTTATTGCAACACTT2654641AATGTTGTCAATGAAAGAGGCTGTGACTATTGCACTATTAGCTTC
KE383757:1079972-1079986
GAGTGGTGTATATAGCTCCCATCTGATCCC1079972AATGTTGTCAATGAAGGAACAGCAGAAAAAATAACCATCTATAGT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/criGri1/TTCATTGACAACATT
lang : en | db : criGri1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.080 | 0.072 | search_plus_done; http://172.18.8.78:28027/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.084 | 0.005 | search_minus_done; http://172.18.8.78:28027/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=48
0.086 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).