GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-08 06:20:19, GGGenome : Zebrafish genome, Zv9/danRer7 (Jul, 2010)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr2:36750858-36750872
CGAGTGACATATTTACTGTACATTTTAAGA36750858TTCATTGACAACATTCAATTGAAACATTTAATTTCAGTTTGCTTT
chr5:2775685-2775699
TTATGTTTGAGGTATAGGCCTATGCTTGCA2775685TTCATTGACAACATTATTAGACCATTTAATTCACTGGTAAAAATC
chr6:32381516-32381530
GAAGGAGAGAATGCCAACAACTTTCCTCGG32381516TTCATTGACAACATTACTGAACAACAACAAGTAAGGGTCTTAAAG
chr12:17226691-17226705
TTTTTTTTTTTTTGTACAATACAAAAAAGA17226691TTCATTGACAACATTTAATTTAAACATCTCAGTTGAAATTGTTGT
chr16:33367834-33367848
GTTTGAGATATAGGCCTATGCTTACAATCT33367834TTCATTGACAACATTATAAGACCATTTAATTCACTGGTAAAATCA
chr18:14608965-14608979
TGCAAAAAAGTGATCTAAATGGCAATGCTC14608965TTCATTGACAACATTCATCACTTGTAGTAGTACACACAAAAAAGT
chr18:47838997-47839011
CCCCTACATACTTTCCATGCAAAGTTAGTC47838997TTCATTGACAACATTGAAAGCTCAGATCCTTGCATTTTAACCTGG
chr23:11479049-11479063
TATTATGTTTGTGATATATGCTTGTCATTT11479049TTCATTGACAACATTATTAGACCTTTTGTTTTTACTGATAAAATG
Zv9_scaffold3455:373091-373105
TGCCGTATGTACACTTGAAACTAAATCTGA373091TTCATTGACAACATTTAAATTGAAACATTTAATTTCAGATGGCTT
Zv9_scaffold3531:71289-71303
GCGTCTGTTGCGGCGAAACTGTTGTCCTGC71289TTCATTGACAACATTGTATGACCTTGGCTCATTTCTTTTTGAAAC
chr1:40198500-40198514
CCACATGGGAAAAGCTAGGCTTCTGCCGGA40198500AATGTTGTCAATGAAACCAGCAAGGAGATCTCAACCTGCGCTCCG
chr2:59304604-59304618
GTTTCAAAAAGAAATGAGCCAAGGTCATAC59304604AATGTTGTCAATGAAGCAGGACAACAGTTTCGCCGCAACAGACGC
chr3:47025362-47025376
GTTTCAAAACGAAATAAGCCAAGGTCATAC47025362AATGTTGTCAATGAAGCAGGACAACAGTTTCGCCACAACAGACGC
chr4:22969823-22969837
GCAGAGCTTCAAAAAAGCATGTTTCAATTA22969823AATGTTGTCAATGAATCAGATTTTTTAAAATGTAAATAATATCAA
chr4:57522933-57522947
GTTTCAAAAAGAAATGAGCCAAGGTCATAC57522933AATGTTGTCAATGAAGCAGGACAACAGTTTCGCCGCAACAGACGC
chr5:48195926-48195940
CATTTTTCCAGTGAAAACTAATGGTTTAAT48195926AATGTTGTCAATGAAAGATGACAAGCACATAAATCAACTTTATAA
chr7:17997401-17997415
AATTTTGTCAATAAATAAAACTTGACTGAA17997401AATGTTGTCAATGAATCAGAAACTATTAAAAAGTACCAAACAAAT
chr7:33520977-33520991
TGATTTTACCAGTGAATAAAATGGTCTAAT33520977AATGTTGTCAATGAAAGATTGCAAGCATATATCTCAAACATAATT
chr7:62418077-62418091
TTGATTTGACCAGTGAAAAAATGGTCTAAT62418077AATGTTGTCAATGAAAGATTGCAAGCATATGTCTCAAACATAATA
chr13:6556702-6556716
TGATTTTACCAGTGAATTAAATGGTCTAAT6556702AATGTTGTCAATGAATGCAAGCATATTTCAAATATAATTCAAAAT
chr20:44826244-44826258
GTTGAGCTACAAATAAGAAAACTGAAATTA44826244AATGTTGTCAATGAATCAGATTTAAAAAAAATTTAAATACTGTCA
Zv9_scaffold3515:372-386
GTTTCAAAAAGAAATGAGCCAAGGTCATAC372AATGTTGTCAATGAAGCAGGACAACAGTTTCGCCGCAACAGACGC
Zv9_scaffold3530:290900-290914
GTTTCAAAAAGAAATGAGCCAAGGTCATAC290900AATGTTGTCAATGAAGCAGGACAACAGTTTCGCCGCAACAGACGC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/danRer7/TTCATTGACAACATT
lang : en | db : danRer7 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.088 | 0.080 | search_plus_done; http://172.18.8.76:28087/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.099 | 0.011 | search_minus_done; http://172.18.8.76:28087/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=40
0.102 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).