GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 10:11:40, GGGenome : Armadillo genome, Baylor/dasNov3 (Dec, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

JH563438:727618-727632
AAGTTGGAGAAAGCCATGTATATGGACAAG727618TTCATTGACAACATTATATGTTATAATGTAAAATGGAAATAGAAA
JH567186:4053425-4053439
TAGAAATTGAAAGATAAATATGTGAAGAAT4053425TTCATTGACAACATTCTGTACAAGGAACATCTGGCATCATAACCC
JH567659:428515-428529
AAGAGATGACAGGAATCTATAGCAAAGTAG428515TTCATTGACAACATTTAACTCTCCAACTAAGAATAAAGCAAATAT
JH569253:313560-313574
AATATCTACCATAACTGTAACTCTTCTCTA313560TTCATTGACAACATTGTTTTTATTTTATAATTTTGTCTTCCACTC
JH570461:2723979-2723993
TCTTCTTATGAAACCCCATGTGGACTTTCA2723979TTCATTGACAACATTTTACTGTAGTCATTAACATCATCTCCACTG
JH575305:61518-61532
GATGGGAAAAGAACAAGTAAAACTTCTCTA61518TTCATTGACAACATTATAATGTATATAGAAAATACTAAGAAATCT
JH578663:48958-48972
TCAGGTAGTAAAAATGATTTACGTTGTTTT48958TTCATTGACAACATTATTGACATTTCCTTATATTCATACATCATT
JH579167:447020-447034
TAGAATATATTATCGCTTCAAACACAGATT447020TTCATTGACAACATTTTGTGGGCATCCATTTAATGTTAATATTAA
JH562293:1908071-1908085
GTCAAATATGAACTTGAGGATGTGGAAAAT1908071AATGTTGTCAATGAAAGAAATGGCAAAATCAGACTGCAAGAGATC
JH563703:915013-915027
AGGGCAGGCTGCAAGCCAGAAACTCCAATG915013AATGTTGTCAATGAATTCGCCTGGAGACACTGGCTGTCTGGAGTA
JH566562:530638-530652
GTAAAGTGTGAAAAACTTCCTGGCCAAAAC530638AATGTTGTCAATGAAGCCACAACTAGCCAATTTGACTCTTATGAT
JH568096:824105-824119
AGATTTTAATAGAAAAACTGCAGATTTTTA824105AATGTTGTCAATGAAGTTATATTTTGAATCAACACTGGCTACCCA
JH568830:3292620-3292634
TATATAATTCTCAATTTCTTGATACATAAC3292620AATGTTGTCAATGAAATCACTGATGAAAAACACAGCATAGGGCAT
JH569070:74927-74941
TTTGAAGGAGAAGGGAAGAGGCTCGGAGAG74927AATGTTGTCAATGAAGAAACTTAAATACCTGATGGACAATGCATG
JH578793:399661-399675
AATGGCATCCTTTTTAGCAGGAAGGAAAAG399661AATGTTGTCAATGAATATGTCTGTGTTGATGATTGTGTCATTACT
JH583056:372621-372635
AAATAAGTTTTTAGTTCAATCATTCAGATC372621AATGTTGTCAATGAATGCTGATTTTCCCCCAGTAGATTTTGTTGT
JH583984:246360-246374
TTTAAAGATTGTACAAGCTCCTGTTTTTAA246360AATGTTGTCAATGAATAATAAAACAAAAAGAAACAAAAGCACTCC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/dasNov3/TTCATTGACAACATT
lang : en | db : dasNov3 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.077 | 0.070 | search_plus_done; http://172.18.8.78:28022/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.083 | 0.006 | search_minus_done; http://172.18.8.78:28022/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=42
0.085 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).