##gff-version 3
##source-version GGGenome v1
track name=GGGenome description="GGGenome matches"
DD018809|DD018809.1 JP 2004159646-A/1: Descrimination of genotype by DNA marker located in the vicinity of pungency locus of plant Capsicum, primers used to detect DNA marker and descrimination of genotype using the same	GGGenome	match	35	58	.	+	.	snippet=AGCAGCGCACCTTAGATTCCGACTTCTAATTTGTCCATGGATTGTTGCTCGGGCCTCCTTTTCTGGGTATTTCAGATTTCATTTATTAGGTAATGCGCTTTCTAACTTGACCCTTTGCTTCTAAAATCTGCACATTCTAGTCGAGTCCATTCATTTAA;snippet_pos=1;snippet_end=158
DD018810|DD018810.1 JP 2004159646-A/2: Descrimination of genotype by DNA marker located in the vicinity of pungency locus of plant Capsicum, primers used to detect DNA marker and descrimination of genotype using the same	GGGenome	match	1	24	.	+	.	snippet=CCATGGATTGTTGCTCGGGCCTCC;snippet_pos=1;snippet_end=24