##gff-version 3
##source-version GGGenome v1
track name=GGGenome description="GGGenome matches"
FB295077|FB295077.1 Sequence 53 from Patent EP1849871.	GGGenome	match	1	23	.	+	.	snippet=GCGAGCTCGAATTCAATTCCAAC;snippet_pos=1;snippet_end=23
FU759612|FU759612.1 JP 2009535026-A/53: Tomato plants having higher levels of resistance to Botrytis.	GGGenome	match	1	23	.	+	.	snippet=GCGAGCTCGAATTCAATTCCAAC;snippet_pos=1;snippet_end=23
GN039875|GN039875.1 Sequence 53 from Patent WO2007123407.	GGGenome	match	1	23	.	+	.	snippet=GCGAGCTCGAATTCAATTCCAAC;snippet_pos=1;snippet_end=23
GZ360162|GZ360162.1 Sequence 45 from patent US 8093455.	GGGenome	match	1	23	.	+	.	snippet=GCGAGCTCGAATTCAATTCCAACCGGGATTTTAGTTTTTCCGATCC;snippet_pos=1;snippet_end=46
HW502160|HW502160.1 JP 2014050395-A/53: Tomato plants having higher levels of resistance to Botrytis.	GGGenome	match	1	23	.	+	.	snippet=GCGAGCTCGAATTCAATTCCAAC;snippet_pos=1;snippet_end=23
JB359029|JB359029.1 Sequence 53 from Patent EP2436770.	GGGenome	match	1	23	.	+	.	snippet=GCGAGCTCGAATTCAATTCCAAC;snippet_pos=1;snippet_end=23