##gff-version 3 ##source-version GGGenome v1 track name=GGGenome description="GGGenome matches" DD018809|DD018809.1 JP 2004159646-A/1: Descrimination of genotype by DNA marker located in the vicinity of pungency locus of plant Capsicum, primers used to detect DNA marker and descrimination of genotype using the same GGGenome match 35 58 . - . snippet=AGCAGCGCACCTTAGATTCCGACTTCTAATTTGTCCATGGATTGTTGCTCGGGCCTCCTTTTCTGGGTATTTCAGATTTCATTTATTAGGTAATGCGCTTTCTAACTTGACCCTTTGCTTCTAAAATCTGCACATTCTAGTCGAGTCCATTCATTTAA;snippet_pos=1;snippet_end=158 DD018810|DD018810.1 JP 2004159646-A/2: Descrimination of genotype by DNA marker located in the vicinity of pungency locus of plant Capsicum, primers used to detect DNA marker and descrimination of genotype using the same GGGenome match 1 24 . - . snippet=CCATGGATTGTTGCTCGGGCCTCC;snippet_pos=1;snippet_end=24