GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-08-13 08:03:00, GGGenome : DDBJ release 119.0, VRL division (Mar, 2020)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Human rhinovirus A strain HRV-A80_p1138_sR1041_2009 polyprotein gene, partial cds.
JN798586.1:3474-3488
CATACACTAGGTGAAGCATTTGGTGCTGGC3474TTCATTGACAACATTAAAGACCAGATCCAATCTATTAACCCCATA
Human rhinovirus A strain HRV-A80_p1187_sR2954_2009 polyprotein gene, partial cds.
JN990705.1:3664-3678
CATACACTAGGTGAAGCATTTGGTGCTGGC3664TTCATTGACAACATTAAAGACCAGATCCAATCTATTAACCCCATA
Shearwaterpox virus strain SWPV-1, complete genome.
KX857216.1:82880-82894
AAAGAATACTCTTTTTTTATATTATATACT82880TTCATTGACAACATTTATTAGTGATGTATAGTATTTATATTTTTA
Daphnia iridovirus 1 genome assembly, chromosome: 1.
LS484712.1:126022-126036
TTATTTTGGGATTTGGAAAAATCATTGAGT126022TTCATTGACAACATTGGACCCCTGTGTCTTGAAGACATAAACGTT
Influenza B virus (B/Georgia/NHRC0001/2001) nucleoprotein (NP) gene, complete cds.
CY099868.1:1475-1489
TATTGCTCTAAGCAAGCAAGCTGTAAGAAG1475AATGTTGTCAATGAATATTGAGGGACGTGATGCAGATGTCAAAGG
Influenza B virus (B/Brisbane/32/2005) nucleoprotein (NP) gene, complete cds.
CY155549.1:1477-1491
TATTGCTCTAAGCAAGCAAGCTGTAAGAAG1477AATGTTGTCAATGAATATTGAGGGACGTGATGCAGATGTCAAAGG
Influenza B virus (B/New York/WC-LVD-13-002/2013) nucleoprotein (NP) gene, complete cds.
CY191374.1:1486-1500
TATTGCTCTAAGCAAGCAAGCTGTAAGAAG1486AATGTTGTCAATGAATATTGAGGGACGTGATGCAGATGTCAAAGG
Influenza B virus (B/Connecticut/31/2017) nucleoprotein (NP) gene, complete cds.
CY237367.1:1495-1509
TATTGCTCTAAGCAAGCAAGCTGTAAGAAG1495AATGTTGTCAATGAATATTGAGGGGCGTGATGCAGATGTCAAAGG
Bat coronavirus Anhui/911/2005 nonfunctional spike protein (S) gene, complete sequence.
EF434380.1:3112-3126
ACCATTTCTCAAGCCCTTAATAAGGTTGAG3112AATGTTGTCAATGAACAAGGAACTGCTTTGTCTCAGTTAACCAAG
Miniopterus bat coronavirus 1, complete genome.
EU420138.1:24179-24193
ACCATTTCCCAAGCCCTTAATAAGGTTGAG24179AATGTTGTCAATGAACAAGGAACTGCTTTGTCTCAGTTAACCAAG
Tobacco streak virus isolate 2334 segment RNA 1, complete sequence.
JX463337.1:1439-1453
GATGAGAAAGGTCTTATCAAGGAAGACTTT1439AATGTTGTCAATGAATTACTCGAAGAAGCCGGGTTAATAGAACCC
BtMf-AlphaCoV/AH2011, complete genome.
KJ473795.1:24177-24191
ACCATTTCTCAAGCCCTTAATAAGGTTGAG24177AATGTTGTCAATGAACAAGGAACTGCTTTGTCCCAGTTAACCAAG
BtMf-AlphaCoV/JX2012, complete genome.
KJ473796.1:24181-24195
ACTATTTCTCAAGCCCTTAATAAGGTTGAA24181AATGTTGTCAATGAACAAGGAACTGCTTTGTCTCAGTTAACCAAG
BtMf-AlphaCoV/GD2012-a spike glycoprotein gene, complete cds.
KJ473801.1:8471-8485
ACCATTTCTCAAGCCCTTAATAAGGTTGAG8471AATGTTGTCAATGAACAAGGAACTGCTTTGTCTCAGTTAACCAAG
BtMf-AlphaCoV/HuB2013-a spike glycoprotein gene, complete cds.
KJ473803.1:8726-8740
ACTATTTCTCAAGCCCTTAATAAGGTTGAG8726AATGTTGTCAATGAACAAGGAACTGCTTTGTCTCAGTTAACCAAG
Tobacco streak virus isolate OK segment RNA 1 replicase gene, complete cds.
KP256522.1:1418-1432
GATGACAAAGGTCTTGTCAAGGAAGACTTT1418AATGTTGTCAATGAATTACTCGAAGATGCTGGTCTCGTTGGTGTG
Influenza B virus (B/Hawaii/35/2014) segment 5 nucleoprotein (NP) gene, complete cds.
KT853530.1:1449-1463
TATTGCTCTAAGCAAGCAAGCTGTAAGAAG1449AATGTTGTCAATGAATATTGAGGGACGTGATGCAGATGTCAAAGG
Astrovirus BatAstV M.bech/GER isolate B6 RNA-dependent RNA polymerase (RdRp) gene, partial cds.
KT894879.1:179-193
TCTGGACAATATTCGACAACTGTTGATAAC179AATGTTGTCAATGAATGGCTAACAGCATATGAGTTTGGCTATTTG
Bat coronavirus isolate 160185 spike glycoprotein gene, complete cds.
KY783846.1:3112-3126
ACTATTTCTCAAGCCCTTAATAAGGTTGAG3112AATGTTGTCAATGAACAAGGAACTGCTTTGTCTCAGTTAACCAAG
Bat coronavirus isolate 160188 spike glycoprotein gene, complete cds.
KY783847.1:3109-3123
ACCATTTCTCAAGCTCTTAATAAGGTTGAG3109AATGTTGTCAATGAACAAGGAACTGCTTTGTCTCAGTTAACCAAG
Bat coronavirus isolate 160201 spike glycoprotein gene, complete cds.
KY783848.1:3112-3126
ACTATTTCTCAAGCCCTTAATAAGGTTGAG3112AATGTTGTCAATGAACAAGGAACTGCTTTGTCTCAGTTAACCAAG
Bat coronavirus isolate 160224 spike glycoprotein gene, complete cds.
KY783850.1:3109-3123
ACCATTTCTCAAGCCCTTAATAAGGTTGAG3109AATGTTGTCAATGAACAAGGAACTGCTTTGTCTCAGTTAACCAAG
Cryptophlebia peltastica nucleopolyhedrovirus, complete genome.
MH394321.1:86144-86158
TGCACCGAAGTTGTGTTTCAACTTTACGAA86144AATGTTGTCAATGAAGGCGCCATTTCTGTAACTCTATAGTTTTAA
Influenza B virus (B/Kentucky/22/2018) segment 5 nucleoprotein (NP) gene, complete cds.
MH584441.1:1495-1509
TATTGCTCTAAGCAAGCAAGCTGTAAGAAG1495AATGTTGTCAATGAATATTGAGGGGCGTGATGCAGATGTCAAAGG
Influenza B virus (B/Wisconsin/06/2019) segment 5 nucleoprotein (NP) gene, complete cds.
MK676319.1:1495-1509
TATTGCTCTAAGCAAGCAAGCTGTAAGAAG1495AATGTTGTCAATGAATATTGAGGGGCGTGATGCAGATGTCAAAGG
Miniopterus schreibersii bat coronavirus 1-related isolate 161454, complete genome.
MN611524.1:24172-24186
ACCATTTCTCAAGCTCTTAATAAGGTTGAG24172AATGTTGTCAATGAACAAGGAACTGCTTTGTCTCAGTTAACCAAG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ddbj119vrl/TTCATTGACAACATT
lang : en | db : ddbj119vrl | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.094 | 0.087 | search_plus_done; http://172.18.8.75:27869/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.159 | 0.065 | search_minus_done; http://172.18.8.75:27869/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=46
0.171 | 0.012 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).