GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-10-29 11:29:46, GGGenome : DDBJ release 120.0, HTC division (Jun, 2020)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Aspergillus oryzae cDNA, contig sequence: AoEST3165.
AB226303.1:974-988
CGTGACGAGGAAGGTCAGGATGTGCTGCTC974TTCATTGACAACATTTTCCGGTTTCACCCAGGCCGGTTCTGAGGT
Papilio xuthus mRNA for ATP synthase-beta, partial cds, sequence id: Px-0449, expressed in epidermis.
AK402800.1:932-946
CGTGACCAGGAGGGTCAGGATGTGCTGCTC932TTCATTGACAACATTTTCCGTTTCACTCAAGCCGGTTCTGAAGTG
Cryptomeria japonica mRNA, clone: CSFL002_L12, expressed in reproductive shoots.
AK414516.1:1224-1238
ATCCAGTCCACAGACCATGGCTATAAATGG1224TTCATTGACAACATTGCTAAACGTCCTTCAAGTTCTTGGTATTAT
Armigeres subalbatus ASAP ID: 41997 hydrogen transporting two sector ATPase mRNA sequence.
AY441405.1:185-199
CGCGATCAAGAAGGACAGGATGTGCTGCTC185TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGGGGTA
Aedes aegypti clone AET-272 F0F1-type ATP synthase beta subunit mRNA, complete cds.
DQ440233.1:838-852
CGTGATCAGGAAGGACAGGATGTGCTGCTC838TTCATTGACAACATTTTCCGTTTCACCCAAGCTGGTTCTGAGGTA
Bombyx mori H+ transporting ATP synthase beta subunit isoform 1 mRNA, complete cds.
DQ443321.1:992-1006
CGTGATCAAGAAGGACAGGATGTACTGCTC992TTCATTGACAACATTTTCCGTTTCACTCAGGCTGGATCAGAAGTG
Bombyx mori H+ transporting ATP synthase beta subunit isoform 2 mRNA, complete cds.
DQ443322.1:975-989
CGTGATCAAGAAGGACAGGATGTACTGCTC975TTCATTGACAACATTTTCCGTTTCACTCAGGCTGGATCAGAAGTG
Codosiga gracilis isolate ATCC 50964 pink-eyed dilution-like 1 mRNA, partial cds.
KU821761.1:1960-1974
GTCCTTTGGGTGTCCGCGATTGCATCTTCT1960TTCATTGACAACATTCCCTTCACCACTGCAATGATTCCTGTGATC
Stephanoeca diplocostata isolate ATCC PRA-392 pink-eyed dilution-like 2 mRNA, complete cds.
KU821781.1:2023-2037
GTGCTGTGGGTGTCGGCCATTGCGTCGTCC2023TTCATTGACAACATTCCGTTCACGGCTGCGATGATTCCCGTCATC
Solanum lycopersicum cDNA, clone: FC12CF10, HTC in fruit.
AK246898.1:376-390
GAGATCATTTACACAAGGACATGGCAAGAA376AATGTTGTCAATGAATTATTTTAGCTTAGAGTCAATTATTTTGTT
Toxoplasma gondii cDNA, clone: XTG01968.2, full cDNA, XTG Sugano cDNA library.
AK318469.1:973-987
TGTTTTGTGTAAGGATATCGGGTCTCTAGA973AATGTTGTCAATGAAGGAATGTCAGATGTGTTGGGCAGATGTTAT
Solanum lycopersicum cDNA, clone: LEFL1073CG06, HTC in leaf.
AK324205.1:754-768
GAGATCATTGACACAAGGACATGGCAAGAA754AATGTTGTCAATGAATTATTTTAGCTTAGAGTCAATTATTTTGTT
Solanum lycopersicum cDNA, clone: LEFL3161B10, HTC in root.
AK329925.1:150-164
GGTTCTAATCAACTCAAGTTTTGGAAAGAA150AATGTTGTCAATGAAATGCCTCCATCTCTTGTTTCTAAATTATCT
Oryza sativa (indica cultivar-group) clone OSE-193-288-F12 osiaa17-auxin-responsive aux/iaa gene family member mRNA, partial cds.
EF575864.1:506-520
TATGATTGAGCACCCCTACCTACTTTGCAA506AATGTTGTCAATGAACTGTTTGTTCGCTACATAAATGTTCAATGA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ddbj120htc/TTCATTGACAACATT
lang : en | db : ddbj120htc | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.081 | 0.074 | search_plus_done; http://172.18.8.73:27517/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.090 | 0.009 | search_minus_done; http://172.18.8.73:27517/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=41
0.093 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).