GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-10-29 11:11:14, GGGenome : DDBJ release 120.0, HTG division (Jun, 2020)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Caenorhabditis elegans clone Y55D5, *** SEQUENCING IN PROGRESS ***, 4 unordered pieces.
AC006880.1:52583-52597
ATTGTAGGAAATTTTGAGCTCTACAAGTAC52583TTCATTGACAACATTTTTGTAACTATTTCTCCCGCTGAGATACGT
Homo sapiens clone RP11-4D12, WORKING DRAFT SEQUENCE, 24 unordered pieces.
AC013582.4:135343-135357
CTAATTAATGAATAGTAAGTATATTTTCTC135343TTCATTGACAACATTTTTCCTCTTACTTTATTGTAAGAATACAAT
Drosophila melanogaster, *** SEQUENCING IN PROGRESS ***.
AC020218.1:18270-18284
GTTAAATAATCTATCAAGCCTAAAGAGCCG18270TTCATTGACAACATTTAATAAGAGGATTAATGGGATTTTAAAGAG
Homo sapiens chromosome 20 clone RP11-186A1 map 20, LOW-PASS SEQUENCE SAMPLING.
AC023022.2:2553-2567
CATTGTGCTGAACACTNTACATTNCTTCAT2553TTCATTGACAACATTCACTGAACACCTGTANGTGCTGGGCTCTGT
Homo sapiens chromosome 1 clone RP11-474M18 map 1, WORKING DRAFT SEQUENCE, 12 unordered pieces.
AC023547.3:110306-110320
TTGGTTTTGTATATATTAAATAGTTGAAAC110306TTCATTGACAACATTAAGTTTGTTTTCTAGGCTCTATTGGGATAA
Homo sapiens chromosome 5 clone CTD-2185N19, WORKING DRAFT SEQUENCE, 35 unordered pieces.
AC025769.3:230404-230418
GAGCCACCATGCCTGGCCTATCTTAGCTTT230404TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAG
Homo sapiens chromosome 4 clone RP11-191O7 map 4, WORKING DRAFT SEQUENCE, 21 unordered pieces.
AC067786.2:152243-152257
CTATTTCAATCAACCATCTTGTAATCATAC152243TTCATTGACAACATTTTACTCATACTATAATAAGTTGCTATTTCT
Mus musculus strain C57BL6/J chromosome 5 clone RP23-348B11, WORKING DRAFT SEQUENCE, 15 unordered pieces.
AC074175.1:58655-58669
GTCAACATGTACTTTAAACTTTAGTAATGT58655TTCATTGACAACATTGATGCTTTTGGCTTGGGGGCATGGATGCTA
Homo sapiens chromosome 8 clone RP11-243G8 map 8, LOW-PASS SEQUENCE SAMPLING.
AC079058.1:21556-21570
AACGAAAGGCGTTTGAGGAAAGCCTGATAA21556TTCATTGACAACATTACCATCAACCACACCTTACCATTCCTAGGA
Rattus norvegicus clone CH230-9J19, WORKING DRAFT SEQUENCE.
AC095204.4:69755-69769
GCTCAAAAAGAAACTGCCTCAAAGACACAG69755TTCATTGACAACATTCTAGAAATTGGACAATGGATACATAAGAGA
Rattus norvegicus clone CH230-7C12, WORKING DRAFT SEQUENCE, 8 unordered pieces.
AC095419.12:72062-72076
TGAATGAAAGGTCAGAGTTCAAGGTGTGAT72062TTCATTGACAACATTAAATATTTACTGAATCTTAAATCTTATCCT
Rattus norvegicus clone CH230-106K7, WORKING DRAFT SEQUENCE, 9 unordered pieces.
AC097862.6:46735-46749
TTTTCAAAATCTTTTGCCTGTATAGACTTT46735TTCATTGACAACATTAAACTGTATGACATGCAAAAAATAACAGGT
Homo sapiens chromosome 15 clone RP11-106G20 map 15, LOW-PASS SEQUENCE SAMPLING.
AC099834.2:51264-51278
ATATTTATATATGTATATATTTCATATTAT51264TTCATTGACAACATTTACTTGGGAGATTTGTCTCAACAAAAATTA
Rattus norvegicus clone CH230-181M16, WORKING DRAFT SEQUENCE, 134 unordered pieces.
AC110677.4:628508-628522
ATTTTTCATGTGTTCGATGAAGCAGCAGTG628508TTCATTGACAACATTTGAAACCCACATACATGAATGAATAAGTAG
Mus musculus clone RP23-370G4, WORKING DRAFT SEQUENCE, 3 ordered pieces.
AC113179.3:72967-72981
ACTTTTCATGTGCTCAACGAAGTAACAGTG72967TTCATTGACAACATTTGAAAGCTACATCAATGAATAAATAGATAT
Rattus norvegicus clone CH230-16O6, WORKING DRAFT SEQUENCE, 2 unordered pieces.
AC114076.4:22686-22700
CACTAGGTTTGGAAAATTTTCTTCCACACC22686TTCATTGACAACATTTTTTTGTTTTTTTGTTTTTTTACTTGGTAT
Rattus norvegicus clone CH230-72E17, WORKING DRAFT SEQUENCE, 2 unordered pieces.
AC115329.3:106966-106980
AAACTGCGCTAAGCAAGACGGTATGGTATT106966TTCATTGACAACATTAAAGAAAATAGAGAGATAGACACTCGTGTG
Rattus norvegicus clone CH230-48L6, WORKING DRAFT SEQUENCE, 5 unordered pieces.
AC122612.4:139967-139981
TTTTTCAGATTATTTGATGAACAGATCTAT139967TTCATTGACAACATTAAAGTTTCAAATGTATAACTGTTGACAATG
Takifugu rubripes clone 263H22, WORKING DRAFT SEQUENCE, 5 ordered pieces.
AC123969.3:19353-19367
TGAATATTCAGGTTGTCAGAGTGAATAAGC19353TTCATTGACAACATTGTCTGTGTTTGGTCATTAATTACGGAGCGG
Rattus norvegicus clone CH230-unknown, WORKING DRAFT SEQUENCE, 9 unordered pieces.
AC137159.1:139084-139098
CACTAGGTTTGGAAAATTTTCTTCCACACC139084TTCATTGACAACATTTTTTTGTTTTTTTGTTTTTTTACTTGGTAT
Rattus norvegicus clone CH230-221L21, WORKING DRAFT SEQUENCE, 79 unordered pieces.
AC139384.3:14047-14061
TTTTTCAGATTATTTGATGAACAGATCTAT14047TTCATTGACAACATTAAAGTTTCAAATGTATAACTGTTGACAATG
Rattus norvegicus clone CH230-482C5, WORKING DRAFT SEQUENCE, 41 unordered pieces.
AC141547.1:144303-144317
ATTTTTCATGTGTTCGATGAAGCAGCAGTG144303TTCATTGACAACATTTGAAACCCACATACATGAATGAATAAGTAG
Rhinolophus ferrumequinum clone VMRC7-330G24, WORKING DRAFT SEQUENCE, 4 ordered pieces.
AC148392.2:40071-40085
GGATGGTTGCGATTTTCAATTGTTAACTGA40071TTCATTGACAACATTTGCAACTTGAGACCTCCAAGTTATTTCTGT
Bos taurus clone CH240-440P5, WORKING DRAFT SEQUENCE.
AC150633.6:91373-91387
ACTCCCCTAAATATAAGTCCCATTTCTCCT91373TTCATTGACAACATTTCAAACAGTATATGTCTTCTGTTTAAATTT
Bos taurus clone CH240-56N2, WORKING DRAFT SEQUENCE, 7 unordered pieces.
AC156915.3:204959-204973
CAGTGACTCCCCCTGACTCACTGCTTTAAA204959TTCATTGACAACATTTTTTAAAAGGTAGAGAATTCTCATGAAAAG
Bos taurus clone CH240-69O22, WORKING DRAFT SEQUENCE, 20 unordered pieces.
AC159483.3:150902-150916
ACTCCCCTAAATATAAGTCCCATTTCTCCT150902TTCATTGACAACATTTCAAACAGTATATGTCTTCTGTTTAAATTT
Bos taurus clone CH240-120C9, WORKING DRAFT SEQUENCE, 64 unordered pieces.
AC162563.4:318090-318104
ATATATGTTTTTAACCAGGGGCTCTACACA318090TTCATTGACAACATTGAAAAATCTCTTTCATTCCCTCCACACATC
Bos taurus clone CH240-165E18, WORKING DRAFT SEQUENCE, 13 unordered pieces.
AC165664.2:8552-8566
AGAAGTGTAATTACTGGGTCAGAATATGGA8552TTCATTGACAACATTTGGGCTTGTTAAAAATTCAGGTTATTGAGT
Strongylocentrotus purpuratus clone R3-13H8, WORKING DRAFT SEQUENCE, 31 unordered pieces.
AC168802.2:28295-28309
CATATCAAGGTTATTATTAAAAAGCCTCTT28295TTCATTGACAACATTTGAAAAGAAAAGAAAAATCCAAAAACCTCT
Bos taurus clone CH240-294L18, WORKING DRAFT SEQUENCE, 12 unordered pieces.
AC171473.4:41641-41655
AGGGAATTCCAGAAAAACATCTACTTCCAT41641TTCATTGACAACATTAAAGCCTTTGACTCTGTGGGTGAAAAATTC
Bos taurus clone CH240-120A2, WORKING DRAFT SEQUENCE, 8 unordered pieces.
AC171891.3:182387-182401
ATATATGTTTTTAACCAGGGGCTCTACACA182387TTCATTGACAACATTGAAAAATCTCTTTCATTCCCTCCACACATC
Strongylocentrotus purpuratus clone R3-1036D2, WORKING DRAFT SEQUENCE, 17 unordered pieces.
AC174509.2:102349-102363
ACTGATACACTGCTTGCTTCCCACTCTGAA102349TTCATTGACAACATTGGTGTCCAATGTACTACCACTAGTCTTGTA
Bos taurus clone CH240-309M12, WORKING DRAFT SEQUENCE, 5 unordered pieces.
AC175440.4:31224-31238
GCCAGTTGACCTTCAGAGCTTAGTTTGAAG31224TTCATTGACAACATTGGGAAGTGAGAATGCCACGGTGGGTCAGAG
Bos taurus clone CH240-397N16, WORKING DRAFT SEQUENCE, 10 unordered pieces.
AC177596.3:133194-133208
CAGTGACTCCCCCTGACTCACTGCTTTAAA133194TTCATTGACAACATTTTTTAAAAGGTAGAGAATTCTCATGAAAAG
Strongylocentrotus purpuratus clone R3-1007L24, WORKING DRAFT SEQUENCE, 20 unordered pieces.
AC179847.1:145715-145729
AGTTTTATTTTGACATAGTGTTCATTACGC145715TTCATTGACAACATTGACATGACTACAGCATCCTTAACACACGTG
Strongylocentrotus purpuratus clone R3-3090B11, WORKING DRAFT SEQUENCE, 34 unordered pieces.
AC184432.1:12689-12703
TTTGTAATTGTTCATATCTTATATCTCACT12689TTCATTGACAACATTCTATAAAACCTCAATGTTCAAACACAATAA
Zea mays cultivar B73 chromosome 4 clone CH201-177D4, *** SEQUENCING IN PROGRESS ***, 12 unordered pieces.
AC184864.6:36338-36352
ATGGAATTTCTTGATAAGTTCATCGTGGTA36338TTCATTGACAACATTCTGGTTTATTCCAAGTATGATGGAGAACAT
Myotis lucifugus clone CH235-294A19, WORKING DRAFT SEQUENCE, 2 ordered pieces.
AC187663.2:115212-115226
CTTTTGATAAATCTCTAAAATGACATGTTA115212TTCATTGACAACATTACTTGAAGGAAAAATAAATAGGAGGACATA
Zea mays cultivar B73 chromosome 2 clone CH201-252L21, *** SEQUENCING IN PROGRESS ***, 17 unordered pieces.
AC187878.5:48943-48957
ATGCCAGAGCTGGACAAGTTTGTGGTGGTT48943TTCATTGACAACATTCTGGTTTATTCCAAAAATGAAGCTGAGCAT
Cavia porcellus clone CH234-504L11, WORKING DRAFT SEQUENCE, 5 ordered pieces.
AC189816.2:53655-53669
AAAAAGTCTTCATTGACAATGACAGGATAC53655TTCATTGACAACATTTAGCGAGGAGCAGGAGAACATTTTCCTAAG
Cavia porcellus clone CH234-165I22, WORKING DRAFT SEQUENCE.
AC189981.1:114959-114973
AAAAAGTCTTCATTGACAATGACAGGATAC114959TTCATTGACAACATTTAGCGAGGAGCAGGAGAACATTTTCCTAAG
Zea mays cultivar B73 chromosome 2 clone CH201-530G21, *** SEQUENCING IN PROGRESS ***, 19 unordered pieces.
AC194000.5:152602-152616
CTTCCTTTTAGAAACAGGTCTACGCGAACT152602TTCATTGACAACATTTGCATATATATATATATATATATATTCATT
Zea mays cultivar B73 chromosome 2 clone CH201-409P7, *** SEQUENCING IN PROGRESS ***, 15 unordered pieces.
AC195228.5:43633-43647
ATGGAATATCTTGATAAGTTTGTTGTGGTA43633TTCATTGACAACATTCTGATCTATTCCAAAAATGATGGAGAAAAT
Zea mays cultivar B73 chromosome 2 clone ZMMBBb-449J3, *** SEQUENCING IN PROGRESS ***, 17 unordered pieces.
AC197674.5:133563-133577
ATGCCAGAGCTGGACAAGTTTGTGGTGGTT133563TTCATTGACAACATTCTGGTTTATTCCAAAAATGAAGCTGAGCAT
Zea mays cultivar B73 chromosome 7 clone ZMMBBb-643N1, *** SEQUENCING IN PROGRESS ***, 9 unordered pieces.
AC198587.5:23056-23070
AGCATTTAAAGCATGATAAATTGTAGAAGG23056TTCATTGACAACATTTCTCCTAGGCATATGAACAACATTTCTACC
Zea mays cultivar B73 chromosome 7 clone CH201-176F9, *** SEQUENCING IN PROGRESS ***, 9 unordered pieces.
AC199224.5:98794-98808
CCTAATAGCAAATTCCGTGTTCCACATCAT98794TTCATTGACAACATTCATCAACTCTTGAATGGAAGCCTTCTCTCT
Zea mays cultivar B73 chromosome 10 clone CH201-408J13, *** SEQUENCING IN PROGRESS ***, 9 unordered pieces.
AC199619.4:102837-102851
ATGGACTATCTCGATAAGTTTGTGGTGGTA102837TTCATTGACAACATTCTGATTTATTCTCAAAGCGAAGAAGAGCAT
Zea mays cultivar B73 chromosome 9 clone CH201-441F3, *** SEQUENCING IN PROGRESS ***, 10 unordered pieces.
AC202061.4:87043-87057
ATGCCCGAGTTGGATAAATTTATGGTGGTC87043TTCATTGACAACATTTTGATCTATTCCAAAAAGTAAGAGGAGCAT
Zea mays cultivar B73 chromosome 5 clone ZMMBBb-537B13, *** SEQUENCING IN PROGRESS ***, 3 unordered pieces.
AC202913.5:49916-49930
ATGGAAGAGCTGGATAAGTTTGTCGTAGTC49916TTCATTGACAACATTCTTATCTACTCCAAGAACCGCGAAGACCAT
Zea mays cultivar B73 chromosome 10 clone CH201-52E5, *** SEQUENCING IN PROGRESS ***, 11 unordered pieces.
AC203309.4:96505-96519
AAGCCCGAATTAGACAAGTTTGTGGTGGTC96505TTCATTGACAACATTTTGATCTATTCCAAGAATGAGGAGGAGCAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ddbj120htg/TTCATTGACAACATT
lang : en | db : ddbj120htg | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.083 | 0.076 | search_plus_done; http://172.18.8.72:27518/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.113 | 0.030 | search_minus_done; http://172.18.8.72:27518/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=0
0.113 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).