GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-10-29 11:13:28, GGGenome : DDBJ release 120.0, PRI division (Jun, 2020)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Pan troglodytes BAC clone CH251-643N11 from chromosome 7, complete sequence.
AC188940.3:129735-129749
TATATTTGTTATAGAATATTATGTTAAATC129735TTCATTGACAACATTAAAGAGTCATACCTTTTATGGGTGTTAGTT
Pan troglodytes BAC clone CH251-639B17 from chromosome 7, complete sequence.
AC192004.3:189879-189893
GTGGTGCCTGGCCTGAGTCAGCTCAGTAGC189879TTCATTGACAACATTGGTTCGTTTAACAAATATTGCCTGAGAAGA
Macaca mulatta BAC CH250-327F20 () complete sequence.
AC202850.6:193298-193312
GTGAGCCACCACACCGGCCTATCTTAGCTT193298TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAG
Macaca fascicularis complete genome, chromosome chr2.
LT160001.1:79404853-79404867
ACTATGCTGCACTCCAAATACTATTGTGTT79404853TTCATTGACAACATTCCCTATTACATATGCATATGAAAAACAGGC
Pan troglodytes BAC clone RP43-41C9 from chromosome 7, complete sequence.
AC145986.2:137372-137386
TCTACAGATTTTGGATTTACCAGCCCCCAC137372AATGTTGTCAATGAATTCCTTAAAATCTCTCTCTCACTGTCTCTC
Pan troglodytes BAC clone RP43-156P2 from chromosome 7, complete sequence.
AC147061.3:141344-141358
AACTAACACCCATAAAAGGTATGACTCTTT141344AATGTTGTCAATGAAGATTTAACATAATATTCTATAACAAATATA
Pan troglodytes BAC clone CH251-50E4 from chromosome 7, complete sequence.
AC189126.2:167589-167603
TCTTCTCAGGCAATATTTGTTAAACGAACC167589AATGTTGTCAATGAAGCTACTGAGCTGACTCAGGCCAGGCACCAC
Pan troglodytes BAC clone CH251-649M9 from chromosome 19, complete sequence.
AC194534.4:153222-153236
CTCCCTTAGGAGAGCTGTTAACATTATACT153222AATGTTGTCAATGAAAAAGCTAAGATAGGCCGGGTGTGGTGGCTT
Pongo abelii BAC clone CH276-41K3 from chromosome 8, complete sequence.
AC200433.3:108392-108406
AATCTAGCCTTGAAAGCCCCTTCCAGAGCC108392AATGTTGTCAATGAAGCTTTCCCTGCTGAATGATAGCTCTCTGGG
Rhesus Macaque BAC CH250-475D9 () complete sequence.
AC202848.5:135471-135485
CTCCCTTAGGAGAGCTGTTAACATTATACT135471AATGTTGTCAATGAAAAGCTAAGATAGGCCGGTGTGGTGGCTCAC
Macaca mulatta BAC CH250-327F20 () complete sequence.
AC202850.6:34848-34862
CTCCCTTAGGAGAGCCGTTAACATTATACT34848AATGTTGTCAATGAAAAAGCTAAGATAGGCAGGGCGTGGTGGCTC
Macaca mulatta BAC CH250-447E21 (Children's Hospital Oakland Research Institute Rhesus macaque Adult Male BAC Library) complete sequence.
AC203030.6:127521-127535
ACTCCCTTAGGAGAGCTGTAACATTATACT127521AATGTTGTCAATGAAAAGCTAAGACAGGCCAGGGGTGGTGGCTCA
Pan troglodytes chromosome 19 clone CH251-349D9, complete sequence.
AC275687.1:143541-143555
CTCCCTTAGGAGAGCTGTTAACATTATACT143541AATGTTGTCAATGAAAAAGCTAAGATAGGCCGGGTGTGGTGGCTT
Gorilla gorilla chromosome 19 clone CH277-16B22, complete sequence.
AC275733.1:94470-94484
CTCCCTTAGGAGAGCTGTTAGCATTATACT94470AATGTTGTCAATGAAAAAGCTAAGATAGGCCAGGCATGGTGGCTC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ddbj120pri/TTCATTGACAACATT
lang : en | db : ddbj120pri | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.072 | search_plus_done; http://172.18.8.76:27502/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.085 | 0.006 | search_minus_done; http://172.18.8.76:27502/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=46
0.091 | 0.005 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).