GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-10-29 11:18:25, GGGenome : DDBJ release 120.0, STS division (Jun, 2020)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

S217P60059FA7.T0 Noemie Pan troglodytes troglodytes STS genomic, sequence tagged site.
BV616112.1:618-632
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA618TTCATTGACAACATTGCCTGAGGTAACTCACACTGAGGTGACAAC
Homo sapiens DNA, STS on chromosome 7, D7S1548i, sequence tagged site.
AB132686.1:207-221
TCTACAGATTTTGGATTTACCAGCCCCCAC207AATGTTGTCAATGAATTCCTTAAAATCTCTCTCTCTCTCTCTCTC
S216P6277FB4.T0 Masuku Pan troglodytes troglodytes STS genomic, sequence tagged site.
BV633065.1:658-672
AATGCCCCACATTTCATTAAGGGTGATGAC658AATGTTGTCAATGAAGAAGTTGCTTCTCATATAACTATACTGTCA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ddbj120sts/TTCATTGACAACATT
lang : en | db : ddbj120sts | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.081 | 0.074 | search_plus_done; http://172.18.8.78:27519/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.086 | 0.005 | search_minus_done; http://172.18.8.78:27519/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=49
0.087 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).