GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-10-29 10:40:46, GGGenome : DDBJ release 120.0, TSA division (Jun, 2020)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

TSA: Armigeres subalbatus ASAP ID ACN-0188192 ATP synthase mRNA sequence.
EU207929.1:213-227
CGCGATCAAGAAGGACAGGATGTGCTGCTC213TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGGGGTA
TSA: Culex tarsalis Ctar-411 ATP synthase beta subunit mRNA, partial cds, mRNA sequence.
EZ000525.1:640-654
CGTGACCAGGAGGGACAGGACGTGCTGCTG640TTCATTGACAACATTTTCCGCTTCACCCAGGCCGGTTCGGAGGTG
TSA: Artemisia annua strain Artemis Contig6533.Aml mRNA sequence.
EZ192976.1:680-694
AGAGATGCCGAAGGACAAGATGTGCTTCTC680TTCATTGACAACATTTTCCGTTTTACCCAGGCTAACTCTGAGGTG
TSA: Artemisia annua strain Artemis Contig26716.Aylt mRNA sequence.
EZ229705.1:1073-1087
AGAGATGCTGAAGGACAAGATGTGCTTCTC1073TTCATTGACAACATTTTCCGTTTCACCCAGGCTAACTCTGAGGTG
TSA: Artemisia annua strain Madagascar Contig13713.Blm mRNA sequence.
EZ307828.1:693-707
AGAGATGCCGAAGGACAAGATGTGCTTCTC693TTCATTGACAACATTTTCCGTTTCACCCAGGCTAACTCTGAGGTG
TSA: Artemisia annua strain Madagascar Contig7513.Blt mRNA sequence.
EZ320967.1:698-712
AGAGATGCCGAAGGACAAGATGTGCTTCTC698TTCATTGACAACATTTTCCGTTTCACCCAGGCTAACTCTGAGGTG
TSA: Artemisia annua strain Uganda Contig4834.Uht mRNA sequence.
EZ357673.1:784-798
AGAGATGCCGAAGGACAAGATGTGCTTCTC784TTCATTGACAACATTTTCCGTTTCACCCAGGCTAACTCTGAGGTG
TSA: Artemisia annua strain Uganda Contig14093.Ulm mRNA sequence.
EZ380642.1:94-108
AGAGATGCTGAAGGACAAGACGTGCTTCTC94TTCATTGACAACATTTTCCGTTTTACCCAGGCTAACTCTGAGGTG
TSA: Artemisia annua strain Uganda Contig15540, mRNA sequence.
EZ399045.1:237-251
AGAGATGCTGAAGGACAAGATGTGCTTCTC237TTCATTGACAACATTTTCCGTTTCACCCAGGCCAACTCTGAGGTG
TSA: Artemisia annua strain Uganda Contig21980, mRNA sequence.
EZ405485.1:772-786
CTAGTCTACGGTCAAATGAACGTGCTTCTC772TTCATTGACAACATTTTCCGTTTCACCCAGGCTAACTCTGAGGTG
TSA: Dermacentor variabilis contig07166.Dva, mRNA sequence.
EZ524416.1:36-50
CGTGACCACGAAGGACAGGACGTGCTGCTC36TTCATTGACAACATTTTCAGGTTCACCCAGGCTGGCTCTGAGGTG
TSA: Dermacentor variabilis contig07453.Dvc, mRNA sequence.
EZ540086.1:101-115
CGTGACCACGAAGGACAGGACGTGCTGCTC101TTCATTGACAACATTTTCAGGTTCACCCAGGCTGGCTCTGAGGTG
TSA: Sarcophaga crassipalpis HAHN.FLY.984.C1 mRNA sequence.
EZ598637.1:183-197
TATGTGGGGAGCCAACAGTGAGGCCAAACC183TTCATTGACAACATTACATGAGAAAGAATTTGCTGAACTCGTGAC
TSA: Sarcophaga crassipalpis HAHN.FLY.10747.C2 mRNA sequence.
EZ610914.1:976-990
CGTGATCAAGAAGGCCAAGATGTATTGCTT976TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTA
TSA: Soil metagenome mRNA, contig: MTC00862.
FX000862.1:272-286
CGTGACGAGGAAGGCCAGGATGTGTTGCTC272TTCATTGACAACATTTTCCGATTCACCCAGGCCGGTTCTGAGGTG
TSA: Soil metagenome mRNA, contig: MTC15963.
FX015963.1:65-79
CGTGATGCTGAGGGTCAGGATGTGCTTCTC65TTCATTGACAACATTTTCCGATTCACTCAGGCCGGTTCCGAGGTG
TSA: Schima mertensiana mRNA, contig: Sm_rep_c3267.
FX148844.1:825-839
CCATTCAAGAGATGACCTTTGATGATTCCA825TTCATTGACAACATTTTCTTCTCTTCTTCCTCCTCTTTCTCCTCC
TSA: Raphanus sativus var. sativus RNA, contig: WG3_1168.
FX674174.1:259-273
CGTGATGCCGAAGGCCAAGATGTGTTGCTT259TTCATTGACAACATTTTCCGTTTCACTCAGGCTAACTCTGAAGTG
TSA: Raphanus sativus var. sativus RNA, contig: WG3_14200.
FX680946.1:240-254
CGTGATGCCGAAGGCCAGGATGTGTTGCTT240TTCATTGACAACATTTTCCGTTTCACTCAGGCTAACTCTGAAGTG
TSA: Brassica rapa subsp. pekinensis RNA, contig: CF3_757.
FX706851.1:46-60
CGTGATGCTGAAGGCCAAGATGTGTTGCTT46TTCATTGACAACATTTTCCGTTTCACTCAGGCTAACTCTGAAGTG
TSA: Brassica rapa subsp. pekinensis RNA, contig: CF3_9230.
FX712463.1:46-60
CGTGATGCTGAAGGCCAAGATGTGTTGCTT46TTCATTGACAACATTTTCCGTTTCACTCAGGCTAACTCTGAAGTG
TSA: Brassica rapa x Raphanus sativus RNA, contig: BB3_6874.
FX749473.1:223-237
CGTGATGCCGAGGGCCAAGATGTGTTGCTT223TTCATTGACAACATTTTCCGATTCACTCAGGCCAACTCTGAAGTG
TSA: Brassica rapa x Raphanus sativus RNA, contig: BB3_15752.
FX757844.1:223-237
CGTGATGCCGAAGGCCAAGATGTGTTGCTT223TTCATTGACAACATTTTCCGTTTCACTCAGGCTAACTCTGAAGTG
TSA: Brassica rapa x Raphanus sativus RNA, contig: BB3_27.
FX758849.1:13-27
GATGTGTTGCTT13TTCATTGACAACATTTTCCGTTTCACTCAGGCTAACTCTGAAGTG
TSA: Brassica rapa x Raphanus sativus RNA, contig: BB3_4247.
FX780715.1:187-201
CGTGATGCTGAAGGCCAAGATGTGTTGCTT187TTCATTGACAACATTTTCCGTTTCACTCAGGCTAACTCTGAAGTG
TSA: Lygodium japonicum RNA, contig: isotig02259_gene=isogroup00121.
FX947309.1:2225-2239
TAATTGTGATAGGGACATCATAACGTTATG2225TTCATTGACAACATTCCCAGAACTTTGTTGTATTACTGGCTCAGG
TSA: Lygodium japonicum RNA, contig: isotig02260_gene=isogroup00121.
FX947310.1:2225-2239
TAATTGTGATAGGGACATCATAACGTTATG2225TTCATTGACAACATTCCCAGAACTTTGTTGTATTACTGGCTCAGG
TSA: Lygodium japonicum RNA, contig: isotig02261_gene=isogroup00121.
FX947311.1:2225-2239
TAATTGTGATAGGGACATCATAACGTTATG2225TTCATTGACAACATTCCCAGAACTTTGTTGTATTACTGGCTCAGG
TSA: Lygodium japonicum RNA, contig: isotig02262_gene=isogroup00121.
FX947312.1:2225-2239
TAATTGTGATAGGGACATCATAACGTTATG2225TTCATTGACAACATTCCCAGAACTTTGTTGTATTACTGGCTCAGG
TSA: Lygodium japonicum RNA, contig: isotig02263_gene=isogroup00121.
FX947313.1:2225-2239
TAATTGTGATAGGGACATCATAACGTTATG2225TTCATTGACAACATTCCCAGAACTTTGTTGTATTACTGGCTCAGG
TSA: Lygodium japonicum RNA, contig: isotig02264_gene=isogroup00121.
FX947314.1:2225-2239
TAATTGTGATAGGGACATCATAACGTTATG2225TTCATTGACAACATTCCCAGAACTTTGTTGTATTACTGGCTCAGG
TSA: Lygodium japonicum RNA, contig: isotig02265_gene=isogroup00121.
FX947315.1:2225-2239
TAATTGTGATAGGGACATCATAACGTTATG2225TTCATTGACAACATTCCCAGAACTTTGTTGTATTACTGGCTCAGG
TSA: Lygodium japonicum RNA, contig: isotig02266_gene=isogroup00121.
FX947316.1:2225-2239
TAATTGTGATAGGGACATCATAACGTTATG2225TTCATTGACAACATTCCCAGAACTTTGTTGTATTACTGGCTCAGG
TSA: Adineta ricciae, contig 30360.
HE701972.1:239-253
TATTTCACTTGACAATTGCGCTTCGTAGAT239TTCATTGACAACATTGTTACCTAATTCTGACATGACTAACAATGT
TSA: Sedum alfredii, clone Sa_Contig10237.
HE727342.1:232-246
AGGGACGCTGAAGGTCAAGATGTGCTTCTC232TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCGGAAGTG
TSA: Psychotria gabriellae, clone contig_3761.
HE824991.1:1102-1116
AGGGATGCAGAAGGGCAGGATGTGCTTCTC1102TTCATTGACAACATTTTCCGTTTTACTCAGGCAAACTCAGAAGTG
TSA: Placobranchus ocellatus 19016.Plocadult mRNA sequence.
HP182860.1:372-386
ATTCACAAAAAGCCACACAAAGTTCATAAT372TTCATTGACAACATTGTCAGTGTCACCGTATTCTCAACTAAAAAG
TSA: Placobranchus ocellatus 21076.Plocadult mRNA sequence.
HP184920.1:67-81
AGCAATTTTAGCTTACATAAAATTATTCGT67TTCATTGACAACATTTCATTAAACTTTTTGTTGTAAAACCGATGC
TSA: Ictalurus furcatus Contig10915.Icfu mRNA sequence.
HP440277.1:886-900
CGTGATCAGGAGGGACAGGACGTGCTGCTT886TTCATTGACAACATTTTCCGCTTCACCCAGGCTGGATCAGAGGTG
TSA: Ictalurus furcatus Contig11840.Icfu mRNA sequence.
HP441176.1:342-356
CGTGATCAGGAGGGACAGGACGTGCTGCTT342TTCATTGACAACATTTTCCGCTTCACCCAGGCTGGATCAGAGGTG
TSA: Apis mellifera isotig24228.Amelbrova mRNA sequence.
HP508150.1:1851-1865
CTTCGTTTTTATAAAAGATATTATTAAAAA1851TTCATTGACAACATTATTTTCATTTAAATATAATATATATTATGT
TSA: Ictalurus punctatus Contig18043.Icpu mRNA sequence.
HP596949.1:901-915
CGTGATCAGGAGGGACAGGACGTGCTGCTT901TTCATTGACAACATTTTCCGCTTCACCCAGGCTGGATCAGAGGTG
TSA: Bemisia tabaci BT_B_ZJU_Singletons99742 mRNA sequence.
HP699394.1:345-359
AAATCGCAAATCTCTCACACATGCAAGGGC345TTCATTGACAACATTATTTTAGATGGCTGCTTATGCTCAAGGAAA
TSA: Ascaris suum ASCF_7137_1183 mRNA sequence.
JI175186.1:54-68
TTGAAATCACCGGTTGTTGTCATCATTGCA54TTCATTGACAACATTTTTGCACTTTTCTTAATGTGCTTTATATGT
TSA: Ananas comosus NODE_7039.Anco mRNA sequence.
JI407315.1:209-223
CGTGATGCCGAAGGGCAAGATGTGCTCCTT209TTCATTGACAACATTTTCCGCTTCACCCAAGCGAACTCAGAAGTG
TSA: Phalaenopsis aphrodite PATC029052 mRNA sequence.
JI683722.1:282-296
ATGTCAAATTCTAAATGCTCATCATCACCT282TTCATTGACAACATTTGTCATTCCTCTTAAGAACATTAACCCAAA
TSA: Phalaenopsis aphrodite PATC145937 mRNA sequence.
JI766274.1:135-149
AAGTGAGCAACTGCTTCAAACACATACATA135TTCATTGACAACATTAAATGCCAATCCGGCTGAGTAGCAAAACCT
TSA: Copidosoma floridanum isotig03701.Coflemb mRNA sequence.
JI834854.1:471-485
CGTGACCAGGAAGGACAAGACGTACTGCTG471TTCATTGACAACATTTTCCGTTTCACTCAAGCTGGTTCTGAGGTA
TSA: Copidosoma floridanum isotig03702.Coflemb mRNA sequence.
JI834855.1:471-485
CGTGACCAGGAAGGACAAGACGTACTGCTG471TTCATTGACAACATTTTCCGTTTCACTCAAGCTGGTTCTGAGGTA
TSA: Siraitia grosvenorii SIG_014389 mRNA sequence.
JL538567.1:168-182
CGTGATGCTGAAGGACAGGATGTGCTTCTC168TTCATTGACAACATTTTCCGCTTTACCCAGGCTAACTCAGAGGTG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ddbj120tsa/TTCATTGACAACATT
lang : en | db : ddbj120tsa | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.223 | 0.216 | search_plus_done; http://172.18.8.72:27515/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.254 | 0.031 | search_minus_done; http://172.18.8.72:27515/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=0
0.254 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).