GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-10-29 11:46:32, GGGenome : DDBJ release 120.0, VRT division (Jun, 2020)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Cyprinus carpio mRNA for ATP synthase beta-subunit, complete cds.
AB023582.1:889-903
CGTGACCAGGAGGGGCAGGATGTGCTGCTA889TTCATTGACAACATTTTCCGCTTCACCCAGGCTGGATCAGAGGTG
Chrysemys picta BAC clone CHY3-119H12 from chromosome unknown, complete sequence.
AC239498.2:19046-19060
ATGGAATGAGAATATAGAAAGGAGTAACAC19046TTCATTGACAACATTAGCTTCTATATGCCTCCATAAGACTTGTTT
Epinephelus fuscoguttatus DNA, LG6, complete sequence.
AP022680.1:18681664-18681678
GCTGAACCCAGCTTTCTCAGTCAATATGCC18681664TTCATTGACAACATTTACCAACAACACTGACTGGACATCCACATA
Epinephelus fuscoguttatus DNA, LG6, complete sequence.
AP022680.1:23920885-23920899
TTAATGTGTTTTTATATATCATGAAAGGCA23920885TTCATTGACAACATTGACTCCTACATCCTACTATTTTTTGTTTAT
Epinephelus fuscoguttatus DNA, LG8, complete sequence.
AP022682.1:45898206-45898220
TGACTCACAATCAATGACACAGAGAAGTCT45898206TTCATTGACAACATTGGTGACATAGTGCAGGACTACAGCGCACTG
Epinephelus fuscoguttatus DNA, LG12, complete sequence.
AP022686.1:11984550-11984564
AGTTAATTAAAAACAAGGTTCCTGTCGTTA11984550TTCATTGACAACATTTCAACATTTGAAACCTTTTCTATATATATA
Epinephelus fuscoguttatus DNA, LG13, complete sequence.
AP022687.1:11284240-11284254
ATAACATCTAACAAGTCTCAACAGCTGCTT11284240TTCATTGACAACATTTATAAACAAATGTCAGTGAACAGAACCTAA
Epinephelus fuscoguttatus DNA, LG13, complete sequence.
AP022687.1:15452939-15452953
GTTTCATGTCGCTTTTCTCTTCTTACTGCC15452939TTCATTGACAACATTATCTTTTGTTGTATTATTTTTGGACAAGCC
Plectropomus leopardus DNA, chromosome 2, nearly complete sequence.
AP022701.1:35803699-35803713
ACAGAGAAAACATAACATGACATTAACACA35803699TTCATTGACAACATTTAACATAGAAGGGGATATATAGTCATGCAA
Plectropomus leopardus DNA, chromosome 11, nearly complete sequence.
AP022710.1:1063900-1063914
GGCCAGCAGGCCCACAGAACCACCAACTTT1063900TTCATTGACAACATTTTGCGGCCGGACTTCGGCTGTAAGAAGGAG
Plectropomus leopardus DNA, chromosome 11, nearly complete sequence.
AP022710.1:6617018-6617032
ACAGAGAAAACATAACATGACATTAACTCG6617018TTCATTGACAACATTTAACACAGAATGGGATATATAGTTCATGCA
Plectropomus leopardus DNA, chromosome 12, nearly complete sequence.
AP022711.1:24777690-24777704
ATAAAAGTTTAAACACTGTTTCCACACATT24777690TTCATTGACAACATTTCAAAACTTTTCTATGACTTTTAAAGGAAC
Plectropomus leopardus DNA, chromosome 15, nearly complete sequence.
AP022714.1:9026144-9026158
CTAAGTCTTACCACAGGGTTTCCACATATT9026144TTCATTGACAACATTTCAAAACTCTACATGATTTTGATGGCCACT
Plectropomus leopardus DNA, chromosome 19, nearly complete sequence.
AP022718.1:23480150-23480164
GTTTCGGGGGCACCAAAGACAAATAAGCCA23480150TTCATTGACAACATTGTAACTGTGCAAATGAGCTAATAAAGCATG
Plectropomus leopardus DNA, chromosome 20, nearly complete sequence.
AP022719.1:14085340-14085354
TTAAGTAATTGCTCAGGGTTTCCACACATT14085340TTCATTGACAACATTTCCAAACTTTTCCATGACTTTTCAAGGACC
Plectropomus leopardus DNA, chromosome 22, nearly complete sequence.
AP022721.1:23831816-23831830
GCAGCAAACATAATGATAAAAATAAAGATC23831816TTCATTGACAACATTATCTGAAAAAACAAATCACATTTAGTAGAT
Plectropomus leopardus DNA, chromosome 23, nearly complete sequence.
AP022722.1:11428485-11428499
TGTGATTTTCTGCAGTTTTCTCATCTGTAA11428485TTCATTGACAACATTATAAAAACTGATTTACTATATGCCTATATA
Xenopus laevis ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit, mRNA (cDNA clone MGC:53838 IMAGE:5542544), complete cds.
BC046741.1:929-943
AGAGATCAAGAGGGACAAGATGTGTTGCTT929TTCATTGACAACATTTTCAGGTTCACCCAGGCTGGTTCAGAGGTG
Xenopus laevis engrailed homolog 2, mRNA (cDNA clone MGC:196517 IMAGE:9041424), complete cds.
BC169790.1:556-570
CACCAGCCCCATCACAGGATAACGAACTTC556TTCATTGACAACATTCTACGGCCGGAGTTCGGGAGGAGGAAAGAA
Xenopus laevis engrailed homolog 2, mRNA (cDNA clone MGC:196519 IMAGE:9041426), complete cds.
BC169792.1:556-570
CACCAGCCCCATCACAGGATAACGAACTTC556TTCATTGACAACATTCTACGGCCGGAGTTCGGGAGGAGGAAAGAA
Zebrafish DNA sequence from clone DKEYP-95B12 in linkage group 16.
BX323565.10:39334-39348
GTTTGAGATATAGGCCTATGCTTACAATCT39334TTCATTGACAACATTATAAGACCATTTAATTCACTGGTAAAATCA
Zebrafish DNA sequence from clone DKEY-84I7 in linkage group 5.
BX465199.9:115149-115163
TTATAAAGTTGATTTATGTGCTTGTCATCT115149TTCATTGACAACATTATTAAACCATTAGTTTTCACTGGAAAAATG
Zebrafish DNA sequence from clone CH211-63C23 in linkage group 10.
BX470204.13:1023-1037
GAAGGAGAGAATGCCAACAACTTTCCTCGG1023TTCATTGACAACATTACTGAACAACAACAAGTAAGGGTCTTAAAG
Oryzias latipes strain HSOK chromosome 22.
CP020642.1:15937799-15937813
TGGTTCAAAACATTCACAGTAATCTGCAGA15937799TTCATTGACAACATTGGTTGTTTGAATTCAGTCTTTGTTTTTTTT
Oryzias latipes strain Hd-rR chromosome 4 sequence.
CP020668.1:5325988-5326002
AATGTGGCAGATCTGAAGGATGTTGTGGAG5325988TTCATTGACAACATTTCTTGGAGCATTAAAAACATATACCAGTAA
Oryzias latipes strain Hd-rR chromosome 22 sequence.
CP020686.1:15802857-15802871
TGGCTCAAAACATTGACAGTTATCTGCAGA15802857TTCATTGACAACATTGGTTGTTTGAATTCAGTCTTTGTTTTTTTT
Oryzias latipes strain HNI chromosome 11.
CP020789.1:24909480-24909494
TTCAGTCCAAACACCAAAGCATCTAATGGT24909480TTCATTGACAACATTACATTGAAATAGCCTATATTTCGTGTCAGC
Oryzias latipes strain HNI chromosome 18.
CP020796.1:12015481-12015495
AGTAGGGACAGTGTTCTTTTCGTTGTATGC12015481TTCATTGACAACATTTTGTAATCAGTTAAGTTTTACAACCACAAA
Oryzias latipes strain HNI chromosome 22.
CP020800.1:15336640-15336654
TGGTTCAAAACATTGACAGTTATCTGCAGA15336640TTCATTGACAACATTGGTTGTTTGAATTCAGTCTTTGTTTTTTTT
Scophthalmus maximus chromosome 8.
CP026250.1:11077150-11077164
AACATTTAATGACTTGGCAGACACACTGTG11077150TTCATTGACAACATTCCCTTATCATAATAAAAAACATAATCAAGA
Scophthalmus maximus chromosome 11.
CP026253.1:21021428-21021442
CCATAGACTGAAGTGTATTTGATTGATTCA21021428TTCATTGACAACATTAACAAAAGAAACGTTTCAAATATATCGTGA
Lateolabrax maculatus chromosome Lm8.
CP027269.1:14183985-14183999
GAATATGTGCAATGCGATGTGATCTTTCAT14183985TTCATTGACAACATTTATTTTGCACATAATTCCACGTCCTCCATT
Lateolabrax maculatus chromosome Lm18.
CP027279.1:4723976-4723990
CACATAAAAGGCAATCAAAACAGGACGAGG4723976TTCATTGACAACATTTGTTTGATGCCGTTACATAAATCCAAACAA
Lateolabrax maculatus chromosome Lm18.
CP027279.1:15067407-15067421
ACAGTAAACATACAACACCATAGGCGTTTT15067407TTCATTGACAACATTGCCAAGATTCAATTTAACTGGGGGAAAATA
Lateolabrax maculatus chromosome Lm23.
CP027284.1:6245923-6245937
TAAATAAAGGCCTGACTCTCTTTGGTTTTG6245923TTCATTGACAACATTATAATATATTTATAAAATACAACATATCAG
Lateolabrax maculatus chromosome Lm23.
CP027284.1:6246316-6246330
TAAATAAAGGCCTGACTCTCTTTGGTTTTG6246316TTCATTGACAACATTATAATATATTTATAAAATACAACATATCAG
Lateolabrax maculatus linkage group 1 sequence.
CP032584.1:6802737-6802751
TAAATAAAGGCCTGACTCTCTTTGGTTTTG6802737TTCATTGACAACATTATAATATATTTATAAAATACAACATATCAG
Lateolabrax maculatus linkage group 12 sequence.
CP032586.1:7745959-7745973
CAGTATCAACATTTTGTGACTTGCCAGACA7745959TTCATTGACAACATTTCCTCAGTATGTTAGTCAACAAATTCTATG
Zebrafish DNA sequence from clone CH211-282F6 in linkage group 3.
CR812464.10:100630-100644
GCGTCTGTTGTGGCGAAACTGTTGTCCTGC100630TTCATTGACAACATTGTATGACCTTGGCTTATTTCGTTTTGAAAC
Zebrafish DNA sequence from clone CH211-237A4 in linkage group 4.
CR812471.13:29589-29603
GCGTCTGTTGCGGCGAAACTGTTGTCCTGC29589TTCATTGACAACATTGTATGACCTTGGCTCATTTCTTTTTGAAAC
Zebrafish DNA sequence from clone CH73-241F5 in linkage group 2.
CU694255.9:47445-47459
GCGTCTGTTGCGGCGAAACTGTTGTCCTGC47445TTCATTGACAACATTGTATGACCTTGGCTCATTTCTTTTTGAAAC
Zebrafish DNA sequence from clone CH73-78K15 in linkage group 1.
CU929244.6:32740-32754
CGGAGCGCAGGTTGAGATCTCCTTGCTGGT32740TTCATTGACAACATTTCCGGCAGAAGCCTAGCTTTTCCCATGTGG
Channa striata mitochondrial ATP synthase subunit beta mRNA, partial cds; nuclear gene for mitochondrial product.
JX644440.1:388-402
CGTGACCAGGAGGGTCAGGATGTGCTGCTC388TTCATTGACAACATTTTCCGGTTCACACAGGCTGGCTCTGAGGTG
Hypophthalmichthys nobilis ATP synthase, H+ transporting, mitochondrial F1 complex, beta subunit mRNA, complete cds; nuclear gene for mitochondrial product.
KF179068.1:905-919
CGTGACCAGGAGGGGCAGGATGTGCTGCTC905TTCATTGACAACATTTTCCGCTTCACCCAGGCTGGGTCAGAGGTG
Hypophthalmichthys molitrix ATP synthase, H+ transporting, mitochondrial F1 complex, beta subunit mRNA, complete cds; nuclear gene for mitochondrial product.
KF179070.1:905-919
CGTGACCAGGAGGGGCAGGATGTGCTGCTC905TTCATTGACAACATTTTCCGCTTCACCCAGGCTGGATCAGAGGTG
Xenopus laevis atp5b.S mRNA for ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide, partial cds, clone: XLap_atp5b-S.
LC315598.1:564-578
AGAGATCAAGAGGGACAAGATGTGTTGCTT564TTCATTGACAACATTTTCAGGTTCACCCAGGCTGGTTCAGAGGTG
Apteryx australis mantelli genome assembly, scaffold: scaffold31.
LK064661.1:11998661-11998675
GGCTTGCTAGAATGAAGCTGCCTTTTTAAG11998661TTCATTGACAACATTAAACAACCTTCTTGAGTGTTTATTGTGAAA
Apteryx australis mantelli genome assembly, scaffold: scaffold7.
LK064712.1:1170596-1170610
GTCTAGCATAATTATCAAGCTTAGCTGCGT1170596TTCATTGACAACATTCTATCTAACCTGGTGAGGTAATTTTAGCTT
Apteryx australis mantelli genome assembly, scaffold: scaffold7.
LK064712.1:8260848-8260862
AGTTGAAATCACACAACAAAGTTTCGCTGT8260848TTCATTGACAACATTCTTTAAGAAGCAATTGTCAGCAGACAAATG
Apteryx australis mantelli genome assembly, scaffold: scaffold178.
LK064747.1:430179-430193
CTCGGAGATCCCTTCTCACCATGGGAAGAC430179TTCATTGACAACATTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ddbj120vrt/TTCATTGACAACATT
lang : en | db : ddbj120vrt | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.116 | 0.109 | search_plus_done; http://172.18.8.77:27505/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.148 | 0.032 | search_minus_done; http://172.18.8.77:27505/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=0
0.148 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).