GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-01 11:59:05, GGGenome : DDBJ release 122.0, PLN division (Jan, 2021)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Pedinophyceae sp. YPF-701 chloroplast AtpB gene for ATP synthase CF1 beta subunit, partial cds.
AB561013.1:347-361
CGTGACGTAAACAAGCAAGACGTTCTTTTA347TTCATTGACAACATTTTCCGTTTCGTACAAGCGGGTTCAGAAGTA
Oryza sativa chromosome 10 clone OSJNBa0087H07, complete sequence.
AC074283.3:87092-87106
ACAAATATATTCACAATATTGATTCACAGG87092TTCATTGACAACATTGAGTCACATACTCATTCACAATATTGATTC
Oryza sativa chromosome 3 BAC OSJNBa0044H10 genomic sequence, complete sequence.
AC084405.6:75548-75562
TGATCCCAATAGTTGTTTATTTTTGGACTC75548TTCATTGACAACATTGCCACTTTGATGACTGTTCTGACATGAATG
Medicago truncatula clone mth2-21k24, complete sequence.
AC121235.20:105578-105592
CTTTAACTCCCTTCAAAATATGAATCAAAC105578TTCATTGACAACATTTATTGTAGCATGTCGAAAATACATGTTTTT
Medicago truncatula clone mth2-36d22, complete sequence.
AC124217.21:23174-23188
ATTAACTTCTTTTCAAAGTCTAAGTCAAAA23174TTCATTGACAACATTTATTATAGCCTATCAAAAATACAGGCTAAC
Oryza sativa Japonica Group chromosome 10 clone Pseudo10p0.0-10p4.4, complete sequence.
AC145127.1:2261438-2261452
ACAAATATATTCACAATATTGATTCACAGG2261438TTCATTGACAACATTGAGTCACATACTCATTCACAATATTGATTC
Cicer arietinum strain FLIP84-92C clone gl1-15o9, complete sequence.
AC145456.1:41857-41871
AGGAATTATGCATTCTGCCATAAACTGCTA41857TTCATTGACAACATTTCCCACATCACTTCCTTAAATTTCCCTACA
Medicago truncatula clone mth2-15m24, complete sequence.
AC148292.9:91765-91779
ATTAACTTCTTTTCAAAGTCTAAGTCAAAA91765TTCATTGACAACATTTATTATAGCCTATCAAAAATACAGGCTAAC
Glycine max strain Williams 82 clone GM_WBb0027P13, complete sequence.
AC235233.1:154767-154781
TTGGATCAATTTTAGCCATTTATACACGAT154767TTCATTGACAACATTGTGGATGTCAAAGCTGATGGTAACTATGGA
Solanum lycopersicum chromosome 3 clone C03HBa0203H10, complete sequence.
AC238462.1:11772-11786
CATTAACCACTAGGCCACACCATTGAGCAC11772TTCATTGACAACATTTACTGATTAAAATTTAATTCAATAAAACAA
Brassica rapa subsp. pekinensis cultivar Inbred line 'Chiifu' clone KBrB022F09, complete sequence.
AC240998.1:80363-80377
CGTGATGCCGAAGGCCAAGATGTGTTGCTT80363TTCATTGACAACATTTTCCGTTTCACTCAGGTGAGCCTTTTTGTT
Solanum lycopersicum strain Heinz 1706 chromosome 10 clone hba-7g17 map 10, complete sequence.
AC244076.4:47296-47310
AGAAGTTACCTAAATTCATTTGTCATTGTC47296TTCATTGACAACATTTTGGTATATTCAAAAAATGTGGGTGAACAC
Passiflora edulis clone Pe51C2, complete sequence.
AC278225.1:9003-9017
AAGTATTTCAGAAGTAATAACTAAGATGAC9003TTCATTGACAACATTTTTATCTCAGGGGTTTACATGCCATTGGGG
Ashbya gossypii ATCC 10895 chromosome II, complete sequence.
AE016815.5:720399-720413
AGAGACGAGGAGGGTCAGGATGTGTTGCTG720399TTCATTGACAACATTTTCAGATTCACCCAAGCCGGTTCCGAAGTG
Salvinia molesta ATP synthase beta chain (atpB) gene, partial cds; chloroplast gene for chloroplast product.
AF313552.1:512-526
CGAGATGTCAACAAGCAAGACGTACTCCTA512TTCATTGACAACATTTTTCGTTTCGTCCAAGCGGGATCAGAAGTC
Arabidopsis thaliana mRNA for mitochondrial F1 ATP synthase beta subunit (p_beta gene).
AJ271468.1:1572-1586
CGTGATGCTGAAGGCCAAGACGTTTTGCTT1572TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
Oryza sativa Japonica Group cDNA clone:001-037-A03, full insert sequence.
AK061681.1:1029-1043
CGTGATGCCGAAGGACAAGATGTGCTTTTG1029TTCATTGACAACATTTTCCGTTTCACTCAGGCGAACTCTGAGGTG
Oryza sativa Japonica Group cDNA clone:002-127-D01, full insert sequence.
AK107392.1:1246-1260
GCTCTCTGATCAACACTCTTTTTCGGAACA1246TTCATTGACAACATTCGTCGAGCTGGACTCGACCATGGATTATGG
Oryza sativa Japonica Group cDNA clone:002-153-G05, full insert sequence.
AK108995.1:907-921
CGTGACCAGGAGGGACAGGATGTCTTGCTC907TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Arabidopsis thaliana At5g08670 mRNA for putative H+-transporting ATP synthase beta chain (mitochondrial), complete cds, clone: RAFL19-76-L24.
AK118538.1:1017-1031
CGTGATGCTGAAGGCCAAGACGTTTTGCTT1017TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
Arabidopsis thaliana At5g08690 mRNA for putative H+-transporting ATP synthase beta chain (mitochondrial), complete cds, clone: RAFL19-82-J07.
AK118582.1:1017-1031
CGTGATGCTGAAGGCCAAGATGTCTTGCTT1017TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
Hordeum vulgare subsp. vulgare mRNA for predicted protein, complete cds, clone: NIASHv1027K09.
AK355900.1:1834-1848
TTTGGCTCAGGTTTACCCTCTTGCCTATTT1834TTCATTGACAACATTTGTCAGTATATCGCTTCTAATTTTACTCAG
Hordeum vulgare subsp. vulgare mRNA for predicted protein, complete cds, clone: NIASHv2010F24.
AK362825.1:829-843
AGAGATGAGGAGGGTAAGGACGTGCTGCTT829TTCATTGACAACATTTTCCGCTTCACCCAAGCTTGCTCAGAGGTG
Hordeum vulgare subsp. vulgare mRNA for predicted protein, complete cds, clone: NIASHv3077J11.
AK374834.1:952-966
CGTGACGAGGAGGGTCAGGATGTGCTTCTC952TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Arabidopsis thaliana DNA chromosome 5, BAC clone T2K12 (ESSA project).
AL590346.1:28840-28854
CGTGATGCTGAAGGCCAAGATGTCTTGCTT28840TTCATTGACAACATTTTCCGTTTCACTCAGGTAAGCCTTGTTATG
Azolla pinnata chloroplast partial atpB gene for putative beta subunit of chloroplast ATP synthase, specimen voucher Schneider s.n. (GOET).
AM176622.1:512-526
CGAGATGTCAACAAGCAAGATGTACTTCCA512TTCATTGACAACATTTTTCGGTTCGTCCAAGCGGGATCAGAAGTC
Salvinia oblongifolia chloroplast partial atpB gene for putative beta subunit of chloroplast ATP synthase, specimen voucher Unknown.
AM176624.1:477-491
CGAGATGTCAACAAGCAAGACGTACTTCTA477TTCATTGACAACATTTTTCGTTTCGTCCAAGCGGGATCAGAAGTC
Vitis vinifera, whole genome shotgun sequence, contig VV78X040248.2, clone ENTAV 115.
AM460727.1:42408-42422
AACAACCAAACAGGTCCTAAACCTCTCACT42408TTCATTGACAACATTATATCCTCAGGTCTTATTCTCTACCATTGT
Vitis vinifera contig VV78X024264.3, whole genome shotgun sequence.
AM482307.1:596-610
TCTTTAAATGGAACAAAATACTATATTCAT596TTCATTGACAACATTATCTTAATGTATTCGGATGATAGGGAAGAC
Oryza sativa Japonica Group genomic DNA, chromosome 7, PAC clone:P0453E05.
AP004275.3:32147-32161
AGATCTATCTAATTTAGGTGTAGTGCTCTC32147TTCATTGACAACATTTTTCACTTCCTGCGTTAGGTTTCCATTATC
Oryza sativa Japonica Group genomic DNA, chromosome 7, PAC clone:P0492E07.
AP004305.3:26834-26848
CGTGTGCCTCCTGGATGCACCAATCGGCTG26834TTCATTGACAACATTTTGTTGAAGGACCTTGGCAACATCTTTTTG
Oryza sativa Japonica Group genomic DNA, chromosome 9, PAC clone:P0556H01.
AP005424.3:30622-30636
CTTTCAAATGATGGTCAAACTAATTATAAA30622TTCATTGACAACATTAACTAAACGAGTGAAGAGTGAAGAGAAGAT
Oryza sativa Japonica Group genomic DNA, chromosome 9, BAC clone:OJ1328_D07.
AP005833.2:126234-126248
CTTTCAAATGATGGTCAAACTAATTATAAA126234TTCATTGACAACATTAACTAAACGAGTGAAGAGTGAAGAGAAGAT
Aspergillus oryzae RIB40 DNA, SC010.
AP007175.1:1292143-1292157
CGTGACGAGGAAGGTCAGGATGTGCTGCTC1292143TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Oryza sativa Japonica Group DNA, chromosome 3, cultivar: Nipponbare, complete sequence.
AP014959.1:9682664-9682678
TGATCCCAATAGTTGTTTATTTTTGGACTC9682664TTCATTGACAACATTGCCACTTTGATGACTGTTCTGACATGAATG
Oryza sativa Japonica Group DNA, chromosome 7, cultivar: Nipponbare, complete sequence.
AP014963.1:12705943-12705957
CGTGTGCCTCCTGGATGCACCAATCGGCTG12705943TTCATTGACAACATTTTGTTGAAGGACCTTGGCAACATCTTTTTG
Oryza sativa Japonica Group DNA, chromosome 7, cultivar: Nipponbare, complete sequence.
AP014963.1:24274176-24274190
AGATCTATCTAATTTAGGTGTAGTGCTCTC24274176TTCATTGACAACATTTTTCACTTCCTGCGTTAGGTTTCCATTATC
Oryza sativa Japonica Group DNA, chromosome 9, cultivar: Nipponbare, complete sequence.
AP014965.1:16180672-16180686
CTTTCAAATGATGGTCAAACTAATTATAAA16180672TTCATTGACAACATTAACTAAACGAGTGAAGAGTGAAGAGAAGAT
Oryza sativa Japonica Group DNA, chromosome 10, cultivar: Nipponbare, complete sequence.
AP014966.1:2282429-2282443
ACAAATATATTCACAATATTGATTCACAGG2282429TTCATTGACAACATTGAGTCACATACTCATTCACAATATTGATTC
Vigna angularis var. angularis DNA, chromosome 2, almost complete sequence, cultivar: Shumari.
AP015035.1:2763351-2763365
GTGTATCAATTAAATCTATTCCGTCAATTT2763351TTCATTGACAACATTAATTGTGTGGTTATGTAGCAAAAGAGTGTA
Vigna angularis var. angularis DNA, chromosome 4, almost complete sequence, cultivar: Shumari.
AP015037.1:17743347-17743361
TCCTCAAGTTGGAAGTTCTTACGCGTATTT17743347TTCATTGACAACATTATTTACTAGAGGTCCTTCACCATTTAGTGT
Vigna angularis var. angularis DNA, chromosome 8, almost complete sequence, cultivar: Shumari.
AP015041.1:3253525-3253539
TATATTTAGGTTTGCAGAATTATAGATGAA3253525TTCATTGACAACATTTGCAATGTTGGTGACCACTTGCTTACTTTG
Prunus dulcis DNA, pseudomolecule Pd03.
AP019299.1:15714560-15714574
GGGTTTTGATGCCAAGCCACGTGTGAGGCT15714560TTCATTGACAACATTTTCTTGCATTAAAAAATTCTAAGGGGACAA
Prunus dulcis DNA, pseudomolecule Pd04.
AP019300.1:4537392-4537406
AATATAGTAGATGAAGGTTGAATCTGGATT4537392TTCATTGACAACATTCAGAAAGGGGTGTATTTGAATAAAAAAGTT
Prunus dulcis DNA, pseudomolecule Pd04.
AP019300.1:6238962-6238976
ATAAGTTTTCTCTGTTCGGTTTAATTATTT6238962TTCATTGACAACATTGGATCATGTTAGAATTTCAAGATAAACAGA
Prunus dulcis DNA, pseudomolecule Pd07.
AP019303.1:11626678-11626692
AACAAACAATTTTAGTAAGTGAAATCTTAA11626678TTCATTGACAACATTCTACAGGAATTTATTAATCTATCTTTCCAG
Marchantia polymorpha subsp. ruderalis Tak-1 DNA, chromosome: 1.
AP019866.1:22155075-22155089
CAAAAAACTATGAATAATTCCATTGATTAT22155075TTCATTGACAACATTGGAGTGATTAGATCACTCAATATAGAATTC
Prunus dulcis DNA, unplaced-scaffold_283.
AP020620.1:8084-8098
GAAGTTTCCCTCTGTTCGGTTTAATTATTT8084TTCATTGACAACATTGGATCATGGTTCCAATTTCAAGAGAAACAA
Lotus japonicus B-129 DNA, chromosome 1, complete sequence.
AP022629.1:45918300-45918314
TTTATAATAGAAGTTTCCTTGAAAAATTTA45918300TTCATTGACAACATTCTTAATTACAGGAGAAACTTGGCTCTATAT
Lotus japonicus B-129 DNA, chromosome 2, complete sequence.
AP022630.1:11714130-11714144
AGACTATTCTTGGACAAGTTCGTGGTGGTG11714130TTCATTGACAACATTCTGATTTACTCGAAGAGAAAAGAGGAACAC
Brassica oleracea HDEM genome, scaffold: C9.
LR031875.1:59900178-59900192
CGTGATGCCGAAGGCCAAGATGTGTTGCTT59900178TTCATTGACAACATTTTCCGTTTCACTCAGGTGAGCTCTGTTCTT
Arabidopsis thaliana genome assembly, chromosome: 5.
LR215056.1:2837116-2837130
CGTGATGCTGAAGGCCAAGATGTCTTGCTT2837116TTCATTGACAACATTTTCCGTTTCACTCAGGTAAGCCTTGTTATG
Arabidopsis thaliana genome assembly, chromosome: 5.
LR699754.1:2839927-2839941
CGTGATGCTGAAGGCCAAGATGTCTTGCTT2839927TTCATTGACAACATTTTCCGTTTCACTCAGGTAAGCCTTGTTATG
Arabidopsis thaliana genome assembly, chromosome: 5.
LR699759.1:2818372-2818386
CGTGATGCTGAAGGCCAAGATGTCTTGCTT2818372TTCATTGACAACATTTTCCGTTTCACTCAGGTAAGCCTTGTTATG
Arabidopsis thaliana genome assembly, chromosome: 5.
LR699764.1:2830385-2830399
CGTGATGCTGAAGGCCAAGATGTCTTGCTT2830385TTCATTGACAACATTTTCCGTTTCACCCAGGTGAGTCTTATTTTG
Arabidopsis thaliana genome assembly, chromosome: 5.
LR699764.1:2836351-2836365
CGTGATGCTGAAGGCCAAGATGTCTTGCTT2836351TTCATTGACAACATTTTCCGTTTCACTCAGGTAAGCCTTGTTATG
Arabidopsis thaliana genome assembly, chromosome: 1.
LR699765.1:15706357-15706371
AATTGTGTATCTATATAAAATGTTATGTTA15706357TTCATTGACAACATTATTCACATCTAAATTATTTTGTGTCTGTTT
Arabidopsis thaliana genome assembly, chromosome: 5.
LR699769.1:2847665-2847679
CGTGATGCTGAAGGCCAAGATGTCTTGCTT2847665TTCATTGACAACATTTTCCGTTTCACTCAGGTAAGCCTTGTTATG
Arabidopsis thaliana genome assembly, chromosome: 5.
LR699774.1:2837116-2837130
CGTGATGCTGAAGGCCAAGATGTCTTGCTT2837116TTCATTGACAACATTTTCCGTTTCACTCAGGTAAGCCTTGTTATG
XXX.
LR721776.1:18151423-18151437
CGTGATGCTGAAGGGCAAGATGTGCTTCTT18151423TTCATTGACAACATTTTCCGTTTTACTCAAGTAAAATTACCTCTT
XXX.
LR721780.1:4995397-4995411
CGAGATGCTGAGGGACAAGATGTGCTTCTT4995397TTCATTGACAACATTTTCCGTTTCACTCAAGTAACTATTCCTTTT
XXX.
LR721781.1:380557-380571
GTAAAGTAAAGTTTTTATTAATAGGTGTTT380557TTCATTGACAACATTAACTGCTAGGACAGATCGTGCTGTGCACTA
XXX.
LR721786.1:9909366-9909380
ATAATCCTATTCTAGGTATGATATTGAAGC9909366TTCATTGACAACATTGACTTCCTTGACTCCATTATACTTACTCAA
XXX.
LR721947.1:5762-5776
AAAAATAGGAGTCTTGCCTGTAGAGTCGGC5762TTCATTGACAACATTTGTCTTTTTCAGTATAAGCTCTAGGACTTT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR722616.1:320918217-320918231
GCATCCAAATAGGCAGAAACTTAGGAGAAT320918217TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTTAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR722618.1:16915552-16915566
CCCATAGTTTTTTAACAACAACATATTTTT16915552TTCATTGACAACATTTTACACAGAGTATTGTGAAATGTCTCACAC
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR722618.1:447595655-447595669
CGCTATGTAATGAGCTCCAACAATATTTTA447595655TTCATTGACAACATTTAGAGCCCATTTGGGACAGCTCTGCTCCTT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 4H.
LR722619.1:488906262-488906276
TCAGACCATGCCTGCCACACATTCAAAATG488906262TTCATTGACAACATTGGAGGGGGTGGCACACTTAGCGGTGCATCA
Armillaria ostoyae strain C18/9 genome assembly, chromosome: LG3.
LR732077.1:4904143-4904157
CGTGATGAGGAGGGTCAGGACGTGTTGCTC4904143TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAAGTG
Spirodela intermedia genome assembly, chromosome: 12.
LR743599.1:1510516-1510530
CCAATTGCTTGAGGTAGTGAATTAATTTGT1510516TTCATTGACAACATTCTCAAATCACATTCCTATTCCCATTGTTTT
Spirodela intermedia genome assembly, chromosome: 12.
LR746275.1:1682992-1683006
CCAATTGCTTGAGGTAGTGAATTAATTTGT1682992TTCATTGACAACATTCTCAAATCACATTCCTATTCCCATTGTTTT
Spirodela intermedia genome assembly, chromosome: 13.
LR746276.1:1422645-1422659
TGAAAGATCACATAATTGGTTGGCTACTAA1422645TTCATTGACAACATTCAGTCCTAACAACCATGACCTCTACTCCTC
Raphanus sativus genome assembly, chromosome: 8.
LR778317.1:28110678-28110692
CGTGATGCCGAAGGCCAAGATGTGTTGCTT28110678TTCATTGACAACATTTTCCGTTTCACTCAGGTGAACTACTATACT
Raphanus sativus genome assembly, chromosome: 9.
LR778318.1:14578880-14578894
CTTCATACAACAGATGAGGATAACTGGAAC14578880TTCATTGACAACATTGGTGACTGTAACTGCCGGAGCTAATACTTT
Arabidopsis thaliana genome assembly, chromosome: 5.
LR782546.1:2832714-2832728
CGTGATGCTGAAGGCCAAGATGTCTTGCTT2832714TTCATTGACAACATTTTCCGTTTCACTCAGGTAAGCCTTGTTATG
Lactuca saligna genome assembly, chromosome: 1.
LR794324.1:19588877-19588891
TCCGTTAACCCTTATTACTTCGTTTATAGT19588877TTCATTGACAACATTCTCAATTTCTTCTTCTTCTTTGGCAACTTC
Lactuca saligna genome assembly, chromosome: 1.
LR794324.1:42572322-42572336
TTCGTTAACCCTTATTACTTCGTTTATAGT42572322TTCATTGACAACATTCTCAATTTCTTCTTCCTCTTTGACAACTTC
Lactuca saligna genome assembly, chromosome: 1.
LR794324.1:81014518-81014532
TTCGTTAACCCCTATTACTTCCTTTACAGT81014518TTCATTGACAACATTCTTAATTTCTTCTTCCTCTTTAACAACTTC
Lactuca saligna genome assembly, chromosome: 1.
LR794324.1:82229076-82229090
AGGCCGATGTTGGATCGCTCGGTGATCGTA82229076TTCATTGACAACATTTTGGTGTATTCGAGATCCAGAGAGCAGCAT
Lactuca saligna genome assembly, chromosome: 1.
LR794324.1:88340240-88340254
AGGCCCATGTTGGACCGGTCGGTGATCGTG88340240TTCATTGACAACATTTTGGTGTACTCAAGGTCTAGGGGACAGCAC
Lactuca saligna genome assembly, chromosome: 1.
LR794324.1:114521820-114521834
CGTCCATTCCTCGACAACTTTGTTATTGTT114521820TTCATTGACAACATTCTAGTTTATTCTCGAAGCAAAAAAGAGCAT
Lactuca saligna genome assembly, chromosome: 1.
LR794324.1:152397659-152397673
CGTCCTTTCTTAGACAAGTTCGTCATTGTG152397659TTCATTGACAACATTCTCACCTACTCTAGAAGCGAAGAAGACCAC
Lactuca saligna genome assembly, chromosome: 2.
LR794325.1:19831337-19831351
AGACCGATGCTGGATTGTTCAATGATTGTG19831337TTCATTGACAACATTTTGGGGTATTCAAAGTCCAGAGAGCAGCAT
Lactuca saligna genome assembly, chromosome: 2.
LR794325.1:29239460-29239474
CGTCCTTTCTTAGACAAATTCGTCATCGTG29239460TTCATTGACAACATTCTCGTCTACTCCAAAAGCGAAGAAGACCAC
Lactuca saligna genome assembly, chromosome: 2.
LR794325.1:120847263-120847277
TCCGTTAACCCTTATTACTTCGTTTATAGT120847263TTCATTGACAACATTCTCAATTTCTTCTTCCTCTTTGACAACTTC
Lactuca saligna genome assembly, chromosome: 2.
LR794325.1:129748360-129748374
TCCGTTAACTCTTATTACTTCGTTTATAGT129748360TTCATTGACAACATTCTCAATTTCTTCTTCCTCTTCTTCATATAA
Lactuca saligna genome assembly, chromosome: 2.
LR794325.1:146124593-146124607
TTTATATATAATAAATCACGACATGCTATC146124593TTCATTGACAACATTTTACGTGTTTAATTTATGTTGGTGTAATAT
Lactuca saligna genome assembly, chromosome: 3.
LR794326.1:30329028-30329042
TCCGTTAACCCTTATTACTTCGTTTATAGT30329028TTCATTGACAACATTCTCAATTTCTTCTTCCTCTTTGACAACTTC
Lactuca saligna genome assembly, chromosome: 3.
LR794326.1:49809597-49809611
TTCGTTAACCCTTATTACTTCGTTTATAGT49809597TTCATTGACAACATTCTCAATTTCTTCTTCCTCTTTGACAACTTC
Lactuca saligna genome assembly, chromosome: 3.
LR794326.1:56208005-56208019
CGACCATCCCTCGAAAACTTTGTTATTGTT56208005TTCATTGACAACATTCTAGTTTATTCTCGAAGCAAAGAAGAACAT
Lactuca saligna genome assembly, chromosome: 3.
LR794326.1:88609918-88609932
TTCATTAACCCTTATTACTTCGTTTATAGT88609918TTCATTGACAACATTCTCAATTTCTTCTTCCTCTTTGACAACTTC
Lactuca saligna genome assembly, chromosome: 3.
LR794326.1:88611008-88611022
TTCGTTAACCCTTATTACTTCGTTTATAGT88611008TTCATTGACAACATTCTCAATTTCTTCTTCCTCTTTGACAACTTC
Lactuca saligna genome assembly, chromosome: 3.
LR794326.1:90529671-90529685
CAACTATTCCTCGACAACTTTGTTATTGTT90529671TTCATTGACAACATTCTAGTTTATTCTCGAAGCAAATAAGAGCAT
Lactuca saligna genome assembly, chromosome: 3.
LR794326.1:130535741-130535755
CGACCATTGCTCGACAACTTTATCATCGTT130535741TTCATTGACAACATTGTAGTTTACTTTCGAAACGAAGAATAGCAC
Lactuca saligna genome assembly, chromosome: 3.
LR794326.1:142850706-142850720
TTTGTTAACCCCTATTACTTCGTTTACAGT142850706TTCATTGACAACATTCTTAATTTCTTCTTCCTCTTTGATAACTTC
Lactuca saligna genome assembly, chromosome: 3.
LR794326.1:150714270-150714284
TCTTCATTAACCCTTATTACTTCTTATAGT150714270TTCATTGACAACATTTCAATTTCTTCTTCTCTTTGACAACTTCTT
Lactuca saligna genome assembly, chromosome: 3.
LR794326.1:166186885-166186899
CGACCATTCCTCGACAACTTTGTTATCGTT166186885TTCATTGACAACATTCTAGTTTATTCTCGAAGCATAGAACAGCAC
Lactuca saligna genome assembly, chromosome: 3.
LR794326.1:173040747-173040761
TGACCATTCTTCAACGACTTTGTTATCGTT173040747TTCATTGACAACATTGTAGTTTATTCTCGAAGCGAAGAGGAGCAT
Lactuca saligna genome assembly, chromosome: 4.
LR794327.1:46440081-46440095
TTCGTTAACCCTTATTACTTCGTTTATAGT46440081TTCATTGACAACATTCTCAATTTCTTCTTCCTCTTTGACAACTTC
Lactuca saligna genome assembly, chromosome: 4.
LR794327.1:108792860-108792874
CAACCATTCCTCGACAACTTTTTTATTGAT108792860TTCATTGACAACATTCTAGTCTATTCCCGAAGCGAAGAAGAGCAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR828115.1:320272311-320272325
GCATCCAAATAGGCAGAAACTTAGGAGAAT320272311TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTCAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828117.1:17019486-17019500
CCCATAGTTTTTTAACAACAACATATTTTT17019486TTCATTGACAACATTTTACACAGAGTATTGTGAAATGTCTCACAC
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828117.1:440362652-440362666
CGCTATGTAATGAGCTCCAACAATATTTTA440362652TTCATTGACAACATTTAGAGCCCATTTGGGACAGCTCTGCTCCTT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 4H.
LR828118.1:474844800-474844814
TCAGACCATGCCTGCCACACATTCAAAATG474844800TTCATTGACAACATTGGAGGGGGTGGCACACTTAGCGGTGCATCA
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR828132.1:337164338-337164352
GCATCCAAATAGGCAGAAACTTAGGAGAAT337164338TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTTAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828134.1:16512423-16512437
CCCATAGTTTTTTAATAACAACATATTTTT16512423TTCATTGACAACATTTTACACAGAGTATTGTGAAATGTCTCACAC
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828134.1:469587502-469587516
CGCTATGTAATGAGCTCCAACAATATTTTA469587502TTCATTGACAACATTTAGAGCCCATTTGGGACAGCTCTGCTCCTT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 4H.
LR828135.1:516083120-516083134
TCAGACCATGCCTGCCACACATTCAAAATG516083120TTCATTGACAACATTGGAGGGGGTGGCACACTTAGCGGTGCATCA
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR828139.1:344355819-344355833
GCATCCAAATAGGCAGAAACTTAGGAGAAT344355819TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTTAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828141.1:17545402-17545416
CCCATAGTTTTTTAACAACAACATATTTTT17545402TTCATTGACAACATTTTACACAGAGTATTGTGAAATGTCTCACAC
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 4H.
LR828142.1:520329488-520329502
TCAGACCATGCCTGCCACACATTCAAAATG520329488TTCATTGACAACATTGGAGGGGGTGGCACACTTAGCGGTGCATCA
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR828153.1:306365569-306365583
GCATCCAAATAGGCAGAAACTTAGGAGAAT306365569TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTCAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828155.1:14032959-14032973
CCCATAGTTTTTTAACAACAACATATTTTT14032959TTCATTGACAACATTTTACACAGAGTATTGTGAAATGTCTCACAC
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828155.1:429128240-429128254
CGCTATGTAATGAGCTCCAACAATATTTTA429128240TTCATTGACAACATTTAGAGCCCATTTGGGACAGCTCTGCTCCTT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 4H.
LR828156.1:470067002-470067016
TCAGACCATGCCTGCCACACATTCAAAATG470067002TTCATTGACAACATTGGAGGGGGTGGCACACTTAGCGGTGCATCA
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR828160.1:330148618-330148632
GCATCCAAATAGGCAGAAACTTAGGAGAAT330148618TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTTAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 4H.
LR828163.1:501421740-501421754
TCAGACCATGCTTGCCACACATTCAAAATG501421740TTCATTGACAACATTGGAGGGGGTGGCACACTTAGCGGTGCATCA
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR828167.1:322410073-322410087
GCATCCAAATAGGCAGAAACTTAGGAGAAT322410073TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTTAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828169.1:16719106-16719120
CCCATAGTTTTTTAACAACAACATATTTTT16719106TTCATTGACAACATTTTACACAGAGTATTGTGAAATGTCTCACAC
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 4H.
LR828170.1:488159504-488159518
TCAGACCATGCCTGCCACACATTCAAAATG488159504TTCATTGACAACATTGGAGGGGGTGGCACACTTAGCGGTGCATCA
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR828174.1:324828195-324828209
GCATCCAAATAGGCAGAAACTTAGGAGAAT324828195TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTTAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828176.1:16960414-16960428
CCCATAGTTTTTTAACAACAACATATTTTT16960414TTCATTGACAACATTTTACACAGAGTATTGTGAAATGTCTCACAC
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 4H.
LR828177.1:490798058-490798072
TCAGACCATGCCTGCCACACATTCAAAATG490798058TTCATTGACAACATTGGAGGGGGTGGCACACTTAGCGGTGCATCA
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR828181.1:322833339-322833353
GCATCCAAATAGGCAGAAACTTAGGAGAAT322833339TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTTAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828183.1:448028472-448028486
CGCTATGTAATGAGCTCCAACAATATTTTA448028472TTCATTGACAACATTTAGAGCCCATTTGGGACAGCTCTGCTCCTT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 4H.
LR828184.1:488702280-488702294
TCAGACCATGCCTGCCACACATTCAAAATG488702280TTCATTGACAACATTGGAGGGGGTGGCACACTTAGCGGTGCATCA
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR828188.1:323150607-323150621
GCATCCAAATAGGCAGAAACTTAGGAGAAT323150607TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTTAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828190.1:16196074-16196088
CCCATAGTTTTTTAATAACAACATATTTTT16196074TTCATTGACAACATTTTACACAGAGTATTGTGAAATGTCTCACAC
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 4H.
LR828191.1:493295969-493295983
TCAGACCATGCCTGCCACACATTCAAAATG493295969TTCATTGACAACATTGGAGGGGGTGGCACACTTAGCGGTGCATCA
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR828266.1:322720672-322720686
GCATCCAAATAGGCAGAAACTTAGGAGAAT322720672TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTTAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828268.1:16696895-16696909
CCCATAGTTTTTTAACAACAACATATTTTT16696895TTCATTGACAACATTTTACACAGAGTATTGTGAAATGTCTCACAC
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828268.1:444816884-444816898
CGCTATGTAATGAGCTCCAACAATATTTTA444816884TTCATTGACAACATTTAGAGCCCATTTGGGACAGCTCTGCTCCTT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 4H.
LR828269.1:487118419-487118433
TCAGACCATGCCTGCCACACATTCAAAATG487118419TTCATTGACAACATTGGAGGGGGTGGCACACTTAGCGGTGCATCA
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR828273.1:332192915-332192929
GCATCCAAATAGGCAGAAACTTAGGAGAAT332192915TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTTAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828275.1:16941939-16941953
CCCATAGTTTTTTAATAACAACATATTTTT16941939TTCATTGACAACATTTTACACAGAGTTTGTGAAATGTCTCACACT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828275.1:463559097-463559111
CGCTATGTAATGAGCTCCAACAATATTTTA463559097TTCATTGACAACATTTAGAGCCCATTTGGGACAGCTCTGCTCCTT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 4H.
LR828276.1:506306493-506306507
TCAGACCATGCCTGCCACACATTCAAAATG506306493TTCATTGACAACATTGGAGGGGGTGGCACACTTAGCGGTGCATCA
Triticum aestivum genome assembly, chromosome: 1A.
LR862508.1:400650294-400650308
CCATGTACAGTACTCTTCCGACAGAAGTCG400650294TTCATTGACAACATTGACCACGCCATGCCAAGAGCACCAGGGCGG
Triticum aestivum genome assembly, chromosome: 1B.
LR862509.1:234036566-234036580
AACGTAGTCCATTGGTCTGCCATGTATCAG234036566TTCATTGACAACATTCTGTACAGAAAAAGACCAAATGGTGTGAAA
Triticum aestivum genome assembly, chromosome: 1D.
LR862510.1:58624414-58624428
CCACGTACAGTACTCTTCCGATGGAAGTCG58624414TTCATTGACAACATTGACCACGCCGCGCTGAGAGCACCAGGGTGG
Triticum aestivum genome assembly, chromosome: 2B.
LR862512.1:143084195-143084209
TATGATCTATATAAATATTATCACTTAAAA143084195TTCATTGACAACATTTCTTAAGAAAAGCAAATTATCCATTCACAA
Triticum aestivum genome assembly, chromosome: 2B.
LR862512.1:304560016-304560030
CAGAGCGCACAGTTAAACCCGGTCTGGTAA304560016TTCATTGACAACATTCACAACAACCGATGGTTATGCATCTAAATG
Triticum aestivum genome assembly, chromosome: 2B.
LR862512.1:488393597-488393611
AGCCATTGTCGGTGAAGTGGCGTCGTATTC488393597TTCATTGACAACATTCGCAACAACAGTTGCAGCCGAAGATGAATA
Triticum aestivum genome assembly, chromosome: 3A.
LR862514.1:125551835-125551849
GAAATGATCACCCATTTTATTATACAACTT125551835TTCATTGACAACATTCATAACTAAAAAGCGTCTCTTCACTGATGT
Triticum aestivum genome assembly, chromosome: 3A.
LR862514.1:384154181-384154195
CCGTATATAGTCGTCTTTCGATGGCTGTCA384154181TTCATTGACAACATTGACAACGCCGCACCGAGAGCACCAAGGCGG
Triticum aestivum genome assembly, chromosome: 3A.
LR862514.1:665498565-665498579
CCGTGTACAGTCGTCTTCCGATGGATGTCG665498565TTCATTGACAACATTGACCACGCCGTGCCGATAGCACTAAGGCGG
Triticum aestivum genome assembly, chromosome: 3B.
LR862515.1:135554796-135554810
AAAGTAGCCCGCTGGTCTGCTCTGTACCAG135554796TTCATTGACAACATTCTGTACAGAAAAAGGCCGAATGGAGTGAAA
Triticum aestivum genome assembly, chromosome: 3B.
LR862515.1:499500883-499500897
GTTTGGCAACTTAAGAGAAGGGATTTTCAA499500883TTCATTGACAACATTGCTAAGAGGCTTAAACAGAAGGAACATCAC
Triticum aestivum genome assembly, chromosome: 4B.
LR862518.1:160069156-160069170
AAAGTAGCCCGACGGTCTGCCCTGTACCAG160069156TTCATTGACAACATTCTATACAGAAAAAGGCCAAACGGAGTGAGA
Triticum aestivum genome assembly, chromosome: 4B.
LR862518.1:200213124-200213138
AAAGTATCTCGTCGGTCCGCCATGTACCAG200213124TTCATTGACAACATTCTGTACAGAAAAAGAACGAATGGTGTGAAA
Triticum aestivum genome assembly, chromosome: 4B.
LR862518.1:249153733-249153747
CCGCGTACAATAATCTTTCGATGGCTGTCG249153733TTCATTGACAACATTGACCACACCACTCCGACAACACCCAGGTGG
Triticum aestivum genome assembly, chromosome: 4B.
LR862518.1:257648275-257648289
GAAATGATCACCCATTTTATTATACTACTT257648275TTCATTGACAACATTCATAACTAAAAAGCGTCTCTTCACTGATGT
Triticum aestivum genome assembly, chromosome: 4B.
LR862518.1:314297027-314297041
AGAGTAGCCCGCCAGTCTACTCTATACCAG314297027TTCATTGACAACATTCTGTACAGAAAAAGACCAAATGGAGTGAAA
Triticum aestivum genome assembly, chromosome: 4B.
LR862518.1:432194374-432194388
CCACGTACAGTCCACGTCCGATGGATGTCA432194374TTCATTGACAACATTGACCAGGCTGCACCGAGAGCACCATGGCGG
Triticum aestivum genome assembly, chromosome: 5A.
LR862520.1:668109699-668109713
TCTCCAGATTGTACAGCTGCAGCAAATTGA668109699TTCATTGACAACATTCTAATTAGTTTCATGCAACACCGTTTGCAG
Triticum aestivum genome assembly, chromosome: 5B.
LR862521.1:540920171-540920185
AAAGTAGCCCGCTGGTCTGCTTTGTATCAA540920171TTCATTGACAACATTTTGTACAGAAGGAGACCGAATGGGGTGAAA
Triticum aestivum genome assembly, chromosome: 6A.
LR862523.1:102472292-102472306
AACCCCTTTACTTTGAAGCTCACATAATCT102472292TTCATTGACAACATTTAGTATGCAAAATAGGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR862524.1:175777773-175777787
AACCCCTTTAGTTTGAACTTAACACAATCT175777773TTCATTGACAACATTCAGTATGTAAAATAAGTATAATCCGAATGT
Triticum aestivum genome assembly, chromosome: 6B.
LR862524.1:175821633-175821647
GAACCCTTTACTTTGAAGCTCACATAATCT175821633TTCATTGACAACATTTAGTATGCAAAATAAGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR862524.1:662828745-662828759
CCCTTCTCTGTCACCACAGTTCTACAAGAA662828745TTCATTGACAACATTTTCAAATTGCATGGCATGCCAGTGTCTATG
Triticum aestivum genome assembly, chromosome: 7B.
LR862527.1:196839660-196839674
CCGTGTATAGTCGTCTTCCGATGGCTGTCG196839660TTCATTGACAACATTGAACATGCTGCACCGAGAGCACCAAGGCGG
Triticum aestivum genome assembly, chromosome: 7B.
LR862527.1:620558839-620558853
TGATTGTTTTCAGGTTTATGTATGTATTGT620558839TTCATTGACAACATTCCTCAAATATCAGGTAGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR862527.1:620599780-620599794
TGATTGTTTTCAGGTTTATGTATGTATTGT620599780TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR862527.1:620631951-620631965
TGATTGTTTTCAGGTTTATGTATGTATTGT620631951TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR862527.1:691463398-691463412
TACTGGTATGGCTTACTTTTGCGCCCCCAT691463398TTCATTGACAACATTCAGGTGGACCACATATGCAACCGAGCCTTG
Triticum aestivum genome assembly, chromosome: 7B.
LR862527.1:735540165-735540179
ATAGCCCGGCTACAGAAACTGGTGCGCCTA735540165TTCATTGACAACATTTACTTCGTGTTTCCTGCTGATATGTTTGGG
Triticum aestivum genome assembly, chromosome: 7D.
LR862528.1:3831995-3832009
GAACTGATCACCCATTTTATTATACATCTT3831995TTCATTGACAACATTCAAAACTGAAAGCGTCTCTTCACGGATGTT
Triticum aestivum genome assembly, chromosome: 7D.
LR862528.1:566066865-566066879
CCATAAGCAGAAAACCAAAGACTGTCCCCC566066865TTCATTGACAACATTGCTTCCGATGAGTCGGTTTGAACAATGATA
Triticum aestivum genome assembly, chromosome: 1A.
LR862529.1:400792246-400792260
CCATGTACAGTACTCTTCCGACAGAAGTCG400792246TTCATTGACAACATTGACCACGCCATGCCAAGAGCACCAGGGCGG
Triticum aestivum genome assembly, chromosome: 1B.
LR862530.1:320439145-320439159
AAAGTTGTCCATCGGTCTGCCCTATACCAG320439145TTCATTGACAACATTCTATACAGAAAAAGACTAAACAAAGTGAAA
Triticum aestivum genome assembly, chromosome: 1D.
LR862531.1:60048585-60048599
CCACGTACAGTACTCTTCCGATGGAAGTCG60048585TTCATTGACAACATTGACCACGCCGCGCTGAGAGCACCAGGGTGG
Triticum aestivum genome assembly, chromosome: 3A.
LR862535.1:122216218-122216232
GAAATGATCACCCATTTTATTATACAACTT122216218TTCATTGACAACATTCATAACTAAAAAGCGTCTCTTCACTGATGT
Triticum aestivum genome assembly, chromosome: 3A.
LR862535.1:657873874-657873888
CCGTGTACAGTCGTCTTCCGATGGATGTCG657873874TTCATTGACAACATTGACCACGCCGTGCCGATAGCACTAAGGCGG
Triticum aestivum genome assembly, chromosome: 3B.
LR862536.1:129868723-129868737
AAAGTAGCCCGCTGGTCTGCTCTGTACCAG129868723TTCATTGACAACATTCTGTACAGAAAAAGGCCGAATGGAGTGAAA
Triticum aestivum genome assembly, chromosome: 3B.
LR862536.1:577099359-577099373
AAAGTAGCCCGTCGGTCTGCCCTGTACCAG577099359TTCATTGACAACATTCTTCATAGAAGAAGACCAAATGGAGTGAAA
Triticum aestivum genome assembly, chromosome: 4A.
LR862538.1:621817168-621817182
CCTTAAAAGCAAACACTTATTTGCCTTCTT621817168TTCATTGACAACATTTAGATGGCCTTTAGTACTCTTTATCTACTT
Triticum aestivum genome assembly, chromosome: 4B.
LR862539.1:157106664-157106678
AAAGTAGCCCGACGGTCTGCCCTGTACCAG157106664TTCATTGACAACATTCTATACAGAAAAAGGCCAAACGGAGTGAGA
Triticum aestivum genome assembly, chromosome: 4B.
LR862539.1:321990460-321990474
CCGCGTACAATAATCTTTCGATGGCTGTCG321990460TTCATTGACAACATTGACCACACCACTCCGACAACACCCAGGTGG
Triticum aestivum genome assembly, chromosome: 4B.
LR862539.1:426078490-426078504
CCACGTACAGTCCACGTCCGATGGATGTCA426078490TTCATTGACAACATTGACCAGGCTGCACCGAGAGCACCATGGCGG
Triticum aestivum genome assembly, chromosome: 7B.
LR862548.1:119665467-119665481
AGAGTAGCCCGCCGGTCTGCTCTATACCAA119665467TTCATTGACAACATTTTGTACAGAAGGAGACCAAATGGGGTGAAA
Triticum aestivum genome assembly, chromosome: 7B.
LR862548.1:194913860-194913874
CCGTGTATAGTCGTCTTCCGATGGCTGTCG194913860TTCATTGACAACATTGAACATGCTGCACCGAGAGCACCAAGGCGG
Triticum aestivum genome assembly, chromosome: 7B.
LR862548.1:609911575-609911589
TGATTGTTTTCAGGTTTATGTATGTATTGT609911575TTCATTGACAACATTCCTCAAATATCAGGTAGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR862548.1:609951755-609951769
TGATTGTTTTCAGGTTTATGTATGTATTGT609951755TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR862548.1:609970764-609970778
TGATTGTTTTCAGGTTTATGTATGTATTGT609970764TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7D.
LR862549.1:4028641-4028655
GAACTGATCACCCATTTTATTATACATCTT4028641TTCATTGACAACATTCAAAACTGAAAGCGTCTCTTCACGGATGTT
Triticum aestivum genome assembly, chromosome: 1A.
LR862550.1:406095945-406095959
CCATGTACAGTACTCTTCCGACAGAAGTCG406095945TTCATTGACAACATTGACCACGCCATGCCAAGAGCACCAGGGCGG
Triticum aestivum genome assembly, chromosome: 1B.
LR862551.1:231188291-231188305
AACGTAGTCCATTGGTCTGCCATGTATCAG231188291TTCATTGACAACATTCTGTACAGAAAAAGACCAAATGGTGTGAAA
Triticum aestivum genome assembly, chromosome: 1D.
LR862552.1:59475185-59475199
CCACGTACAGTACTCTTCCGATGGAAGTCG59475185TTCATTGACAACATTGACCACGCCGCGCTGAGAGCACCAGGGTGG
Triticum aestivum genome assembly, chromosome: 2B.
LR862554.1:148552255-148552269
TATGATCTATATAAATATTATCACTTAAAA148552255TTCATTGACAACATTTCTTAAGAAAAGCAAATTATCCATTCACAA
Triticum aestivum genome assembly, chromosome: 2B.
LR862554.1:292991562-292991576
AAAGTACCCCGTCTATTTGCCTTGTACCAG292991562TTCATTGACAACATTCTATATAGAAAAATACCAAACAGAGTGAAA
Triticum aestivum genome assembly, chromosome: 2B.
LR862554.1:494187183-494187197
AGCCATTGTCGGTGAAGTGGCGTCGTATTC494187183TTCATTGACAACATTCGCAACAACAGTTGCAGCCGAAGATGAATA
Triticum aestivum genome assembly, chromosome: 3A.
LR862556.1:123944926-123944940
GAAATGATCACCCATTTTATTATACAACTT123944926TTCATTGACAACATTCATAACTAAAAAGCGTCTCTTCACTGATGT
Triticum aestivum genome assembly, chromosome: 3A.
LR862556.1:381612921-381612935
CCGTATATAGTCGTCTTTCGATGGCTGTCA381612921TTCATTGACAACATTGACAACGCCGCACCGAGAGCACCAAGGCGG
Triticum aestivum genome assembly, chromosome: 3A.
LR862556.1:662060343-662060357
CCGTGTACAGTCGTCTTCCGATGGATGTCG662060343TTCATTGACAACATTGACCACGCCGTGCCGATAGCACTAAGGCGG
Triticum aestivum genome assembly, chromosome: 3B.
LR862557.1:137812867-137812881
AAAGTAGCCCGCTGGTCTGCTCTGTACCAG137812867TTCATTGACAACATTCTGTACAGAAAAAGGCCGAATGGAGTGAAA
Triticum aestivum genome assembly, chromosome: 4B.
LR862560.1:158135720-158135734
AAAGTAGCCCGACGGTCTGCCCTGTACCAG158135720TTCATTGACAACATTCTATACAGAAAAAGGCCAAACGGAGTGAGA
Triticum aestivum genome assembly, chromosome: 4B.
LR862560.1:198206851-198206865
AAAGTATCTCGTCGGTCCGCCATGTACCAG198206851TTCATTGACAACATTCTGTACAGAAAAAGAACGAATGGTGTGAAA
Triticum aestivum genome assembly, chromosome: 4B.
LR862560.1:434122580-434122594
CCACGTACAGTCCACGTCCGATGGATGTCA434122580TTCATTGACAACATTGACCAGGCTGCACCGAGAGCACCATGGCGG
Triticum aestivum genome assembly, chromosome: 5A.
LR862562.1:663623715-663623729
TCTCCAGATTGTACAGCTGCAGCAAATTGA663623715TTCATTGACAACATTCTAATTAGTTTCATGCAACACCGTTTGCAG
Triticum aestivum genome assembly, chromosome: 5B.
LR862563.1:360681451-360681465
AAAGTAGCCCGCCGGTCTGCCCTGTATCAG360681451TTCATTGACAACATTCTATACAGAAAAATACCGAACGGGGTGAAA
Triticum aestivum genome assembly, chromosome: 6A.
LR862565.1:65270903-65270917
TACCATCCTTGCCCATCAATGATTTGTGTT65270903TTCATTGACAACATTCTTGCCTTCCCTCCAACACAAACTTCTTCG
Triticum aestivum genome assembly, chromosome: 6A.
LR862565.1:108669354-108669368
AACCCCTTTACTTTGAAGCTCACATAATCT108669354TTCATTGACAACATTTAGTATGCAAAATAGGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR862566.1:172933077-172933091
AACCCCTTTAGTTTGAACTTAACACAATCT172933077TTCATTGACAACATTCAGTATGTAAAATAAGTATAATCCGAATGT
Triticum aestivum genome assembly, chromosome: 6B.
LR862566.1:172976156-172976170
GAACCCTTTACTTTGAAGCTCACATAATCT172976156TTCATTGACAACATTTAGTATGCAAAATAAGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR862566.1:658349913-658349927
CCCTTCTCTGTCACCACAGTTCTACAAGAA658349913TTCATTGACAACATTTTCAAATTGCATGGCATGCCAGTGTCTATG
Triticum aestivum genome assembly, chromosome: 7A.
LR862568.1:11504031-11504045
GAACTGATTACCCATTTTATTATACATCTT11504031TTCATTGACAACATTCAAAACTGAAAGGGTCTCTTCACGGATGTT
Triticum aestivum genome assembly, chromosome: 7B.
LR862569.1:134052522-134052536
TGATTGTTTTCAGGTTTATGTATGTATTGT134052522TTCATTGACAACATTCCTCAAATATCAGGTAGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR862569.1:169890819-169890833
GATTGTTTTTCAGCTTTTTGTATGTATTGT169890819TTCATTGACAACATTCCTCAAATATCACTAATTATTTAGATTAAA
Triticum aestivum genome assembly, chromosome: 7B.
LR862569.1:283381196-283381210
AAAGTAGCCCGTCGGTCAAGCATGTACCAG283381196TTCATTGACAACATTCTGTACAGAAAAAGACCAAATGGGGTGAAA
Triticum aestivum genome assembly, chromosome: 7B.
LR862569.1:816563166-816563180
AAAGTAGCCCGCTGGTCTGCTTTGTATCAA816563166TTCATTGACAACATTTTGTACAGAAGGAGACCGAATGGGGTGAAA
Triticum aestivum genome assembly, chromosome: 7B.
LR862569.1:948889295-948889309
GGCAACCACCCGTGTCGCGGTCTCACTCTC948889295TTCATTGACAACATTTGCCACCCGATGACGCTCTAATTTGTCAAG
Triticum aestivum genome assembly, chromosome: 7D.
LR862570.1:1545721-1545735
GAACTGATCACCCATTTTATTATACATCTT1545721TTCATTGACAACATTCAAAACTGAAAGCGTCTCTTCACGGATGTT
Triticum aestivum genome assembly, chromosome: 7D.
LR862570.1:567349979-567349993
CCATAAGCAGAAAACCAAAGACTGTCCCCC567349979TTCATTGACAACATTGCTTCCGATGAGTCGGTTTGAACAATGATA
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR865395.1:308686299-308686313
GCATCCAAATAGGCAGAAACTTAGGAGAAT308686299TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTTAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR865397.1:14532174-14532188
CCCATAGTTTTTTAACAACAACATATTTTT14532174TTCATTGACAACATTTTACACAGAGTATTGTGAAATGTCTCACAC
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR865397.1:431592120-431592134
CGCTATGTAATGAGCTCCAACAATATTTTA431592120TTCATTGACAACATTTAGAGCCCATTTGGGACAGCTCTGCTCCTT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 4H.
LR865398.1:465899703-465899717
TCAGACCATGCCTGCCACACATTCAAAATG465899703TTCATTGACAACATTGGAGGGGGTGGCACACTTAGCGGTGCATCA
Triticum aestivum genome assembly, chromosome: 1A.
LR865458.1:398347744-398347758
CCATGTACAGTACTCTTCCGACAGAAGTCG398347744TTCATTGACAACATTGACCACGCCATGCCAAGAGCACCAGGGCGG
Triticum aestivum genome assembly, chromosome: 1D.
LR865460.1:59743149-59743163
CCACGTACAGTACTCTTCCGATGGAAGTCG59743149TTCATTGACAACATTGACCACGCCGCGCTGAGAGCACCAGGGTGG
Triticum aestivum genome assembly, chromosome: 2B.
LR865462.1:143205134-143205148
TATGATCTATATAAATATTATCACTTAAAA143205134TTCATTGACAACATTTCTTAAGAAAAGCAAATTATCCATTCACAA
Triticum aestivum genome assembly, chromosome: 2B.
LR865462.1:303702466-303702480
CAGAGCGCACAGTTAAACCCGGTCTGGTAA303702466TTCATTGACAACATTCACAACAACCGATGGTTATGCATCTAAATG
Triticum aestivum genome assembly, chromosome: 2B.
LR865462.1:483330609-483330623
AGCCATTGTCGGTGAAGTGGCGTCGTATTC483330609TTCATTGACAACATTCGCAACAACAGTTGCAGCCGAAGATGAATA
Triticum aestivum genome assembly, chromosome: 3A.
LR865464.1:119053998-119054012
GAAATGATCACCCATTTTATTATACAACTT119053998TTCATTGACAACATTCATAACTAAAAAGCGTCTCTTCACTGATGT
Triticum aestivum genome assembly, chromosome: 3A.
LR865464.1:373272461-373272475
CCGTATATAGTCGTCTTTCGATGGCTGTCA373272461TTCATTGACAACATTGACAACGCCGCACCGAGAGCACCAAGGCGG
Triticum aestivum genome assembly, chromosome: 3A.
LR865464.1:651862265-651862279
CCGTGTACAGTTGTCTTCCGATGGATGTCG651862265TTCATTGACAACATTGACCACGCCGTGCCGATAGCACTAAGGCGG
Triticum aestivum genome assembly, chromosome: 3B.
LR865465.1:135594738-135594752
AAAGTAGCCCGCTGGTCTGCTCTGTACCAG135594738TTCATTGACAACATTCTGTACAGAAAAAGGCCGAATGGAGTGAAA
Triticum aestivum genome assembly, chromosome: 3B.
LR865465.1:769961291-769961305
TCGCCTCTGTTGCGCAAGGGTGTGCTTGTA769961291TTCATTGACAACATTCTGGTATAATGAAGATATCATTTTAATTTT
Triticum aestivum genome assembly, chromosome: 4B.
LR865468.1:157112385-157112399
AAAGTAGCCCGACGGTCTGCCCTGTACCAG157112385TTCATTGACAACATTCTATACAGAAAAAGGCCAAACGGAGTGAGA
Triticum aestivum genome assembly, chromosome: 4B.
LR865468.1:196824935-196824949
AAAGTATCTCGTCGGTCCGCCATGTACCAG196824935TTCATTGACAACATTCTGTACAGAAAAAGAACGAATGGTGTGAAA
Triticum aestivum genome assembly, chromosome: 3B.
LR865486.1:486388345-486388359
GTTTGGCAACTTAAGAGAAGGGATTTTCAA486388345TTCATTGACAACATTGCTAAGAGGCTTAAACAGAAGGAACATCAC
Triticum aestivum genome assembly, chromosome: 3B.
LR865486.1:574192871-574192885
AAAGTAGCCCGCCGGTCTGCCCTGTACCAG574192871TTCATTGACAACATTCTTCATAGAAGAAGACCAAATGGAGTGAAA
Triticum aestivum genome assembly, chromosome: 4B.
LR865489.1:156629486-156629500
AAAGTAGCCCGACGGTCTGCCCTGTACCAG156629486TTCATTGACAACATTCTATACAGAAAAAGGCCAAACGGAGTGAGA
Triticum aestivum genome assembly, chromosome: 4B.
LR865489.1:196676596-196676610
AAAGTATCTCGTCGGTCCGCCATGTACCAG196676596TTCATTGACAACATTCTGTACAGAAAAAGAACGAATGGTGTGAAA
Triticum aestivum genome assembly, chromosome: 4B.
LR865489.1:325329869-325329883
CCGCGTACAATAATCTTTCGATGGCTGTCG325329869TTCATTGACAACATTGACCACACCACTCCGACAACACCCAGGTGG
Triticum aestivum genome assembly, chromosome: 4B.
LR865489.1:332500535-332500549
GAAATGATCACCCATTTTATTATACTACTT332500535TTCATTGACAACATTCATAACTAAAAAGCGTCTCTTCACTGATGT
Triticum aestivum genome assembly, chromosome: 4B.
LR865489.1:427801084-427801098
CCACGTACAGTCCACGTCCGATGGATGTCA427801084TTCATTGACAACATTGACCAGGCTGCACCGAGAGCACCATGGCGG
Triticum aestivum genome assembly, chromosome: 4B.
LR865489.1:517022327-517022341
AAAGTAGCCTGCCGGTCTGCTCTGTATCAA517022327TTCATTGACAACATTTTGTACAGACAGAGACCGAATGGGGTGAAA
Triticum aestivum genome assembly, chromosome: 5A.
LR865491.1:665732276-665732290
TCTCCAGATTGTACAGCTGCAGCAAATTGA665732276TTCATTGACAACATTCTAATTAGTTTCATGCAACACCGTTTGCAG
Triticum aestivum genome assembly, chromosome: 5B.
LR865492.1:549102926-549102940
AAAGTAGCCCGCTGGTCTGCTTTGTATCAA549102926TTCATTGACAACATTTTGTACAGAAGGAGACCGAATGGGGTGAAA
Triticum aestivum genome assembly, chromosome: 6A.
LR865494.1:78592923-78592937
AACCCCTTTACTTTGAAGCTCACATAATCT78592923TTCATTGACAACATTTAGTATGCAAAATAGGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR865495.1:169020563-169020577
GAACCCTTTACTTTGAAGCTCACATAATCT169020563TTCATTGACAACATTTAGTATGCAAAATAAGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR865495.1:594382419-594382433
AAAGTAGCCCGTTGGTCTGCCATGTATCAG594382419TTCATTGACAACATTCTGTACAGAAAAAGACTAAACGGTGTGAAA
Triticum aestivum genome assembly, chromosome: 6B.
LR865495.1:648667484-648667498
CCCTTCTCTGTCACCACAGTTCTACAAGAA648667484TTCATTGACAACATTTTCAAATTGCATGGCATGCCAGTGTCTATG
Triticum aestivum genome assembly, chromosome: 7B.
LR865498.1:189999712-189999726
CCGTGTATAGTCGTCTTCCGATGGCTGTCG189999712TTCATTGACAACATTGAACATGCTGCACCGAGAGCACCAAGGCGG
Triticum aestivum genome assembly, chromosome: 7B.
LR865498.1:609680448-609680462
TGATTGTTTTCAGGTTTATGTATGTATTGT609680448TTCATTGACAACATTCCTCAAATATCAGGTAGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR865498.1:609714984-609714998
TGATTGTTTTCAGGTTTATGTATGTATTGT609714984TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR865498.1:609747159-609747173
TGATTGTTTTCAGGTTTATGTATGTATTGT609747159TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR865498.1:679183004-679183018
TACTGGTATGGCTTACTTTTGCGCCCCCAT679183004TTCATTGACAACATTCAGGTGGACCACATATGCAACTGAGCCTTG
Triticum aestivum genome assembly, chromosome: 7D.
LR865499.1:565626744-565626758
CCATAAGCAGAAAACCAAAGACTGTCCCCC565626744TTCATTGACAACATTGCTTCCGATGAGTCGGTTTGAACAATGATA
Triticum aestivum genome assembly, chromosome: 1A.
LR865500.1:395728862-395728876
CCATGTACAGTACTCTTCCGACAGAAGTCG395728862TTCATTGACAACATTGACCACGCCATGCCAAGAGCACCAGGGCGG
Triticum aestivum genome assembly, chromosome: 1B.
LR865501.1:235819761-235819775
AACGTAGTCCATTGGTCTGCCATGTATCAG235819761TTCATTGACAACATTCTGTACAGAAAAAGACCAAATGGTGTGAAA
Triticum aestivum genome assembly, chromosome: 1D.
LR865502.1:60385687-60385701
CCACGTACAGTACTCTTCCGATGGAAGTCG60385687TTCATTGACAACATTGACCACGCCGCGCTGAGAGCACCAGGGTGG
Triticum aestivum genome assembly, chromosome: 2A.
LR865503.1:789005574-789005588
CCTTTCAATGTCAAGAGTGTTGCTCAACTT789005574TTCATTGACAACATTATCAAGCTGCATGGTCCTCCAATTGCTATT
Triticum aestivum genome assembly, chromosome: 2B.
LR865504.1:145418862-145418876
TATGATCTATATAAATATTATCACTTAAAA145418862TTCATTGACAACATTTCTTAAGAAAAGCAAATTATCCATTCACAA
Triticum aestivum genome assembly, chromosome: 2B.
LR865504.1:307294039-307294053
CAGAGCGCACAGTTAAACCCGGTCTGGTAA307294039TTCATTGACAACATTCACAACAACCGATGGTTATGCATCTAAATG
Triticum aestivum genome assembly, chromosome: 2B.
LR865504.1:491518135-491518149
AGCCATTGTCGGTGAAGTGGCGTCGTATTC491518135TTCATTGACAACATTCGCAACAACAGTTGCAGCCGAAGATGAATA
Triticum aestivum genome assembly, chromosome: 3A.
LR865506.1:126463814-126463828
GAAATGATCACCCATTTTATTATACAACTT126463814TTCATTGACAACATTCATAACTAAAAAGCGTCTCTTCACTGATGT
Triticum aestivum genome assembly, chromosome: 3A.
LR865506.1:386649363-386649377
CCGTATATAGTCGTCTTTCGATGGCTGTCA386649363TTCATTGACAACATTGACAACGCCGCACCGAGAGCACCAAGGCGG
Triticum aestivum genome assembly, chromosome: 3A.
LR865506.1:667381436-667381450
CCGTGTACAGTCGTCTTCCGATGGATGTCA667381436TTCATTGACAACATTGACCACGCCGTGCCGATAGCACTAAGGCGG
Triticum aestivum genome assembly, chromosome: 3B.
LR865507.1:133451398-133451412
AAAGTAGCCCGCTGGTCTGCTCTGTACCAG133451398TTCATTGACAACATTCTGTACAGAAAAAGGCCGAATGGAGTGAAA
Triticum aestivum genome assembly, chromosome: 3B.
LR865507.1:495527486-495527500
GTTTGGCAACTTAAGAGAAGGGATTTTCAA495527486TTCATTGACAACATTGCTAAGAGGCTTAAACAGAAGGAACATCAC
Triticum aestivum genome assembly, chromosome: 4B.
LR865510.1:157658881-157658895
AAAGTAGCCCGACGGTCTGCCCTGTACCAG157658881TTCATTGACAACATTCTATACAGAAAAAGGCCAAACGGAGTGAGA
Triticum aestivum genome assembly, chromosome: 4B.
LR865510.1:197669727-197669741
AAAGTATCTCGTCGGTCCGCCATGTACCAG197669727TTCATTGACAACATTCTGTACAGAAAAAGAACGAATGGTGTGAAA
Triticum aestivum genome assembly, chromosome: 4B.
LR865510.1:324782320-324782334
AGAGTAGCCCGCCAGTCTACTCTATACCAG324782320TTCATTGACAACATTCTGTACAGAAAAAGACCAAATGGAGTGAAA
Triticum aestivum genome assembly, chromosome: 4B.
LR865510.1:426225325-426225339
CCACGTACAGTCCACGTCCGATGGATGTCA426225325TTCATTGACAACATTGACCAGGCTGCACCGAGAGCACCATGGCGG
Triticum aestivum genome assembly, chromosome: 5A.
LR865512.1:663866379-663866393
TCTCCAGATTGTACAGCTGCAGCAAATTGA663866379TTCATTGACAACATTCTAATTAGTTTCATGCAACACCGTTTCCAG
Triticum aestivum genome assembly, chromosome: 5B.
LR865513.1:563324653-563324667
AAAGTAGCCCGCTGGTCTGCTTTGTATCAA563324653TTCATTGACAACATTTTGTACAGAAGGAGACCGAATGGGGTGAAA
Triticum aestivum genome assembly, chromosome: 5B.
LR865513.1:699909196-699909210
GGCAACCACCCGTGTCGCGGTCTCACTCTC699909196TTCATTGACAACATTTGCCACCCGATGACGCTCTAATTTGTCAAG
Triticum aestivum genome assembly, chromosome: 6A.
LR865515.1:63000743-63000757
TACCATCCTTGCCCATCAATGATTTGTGTT63000743TTCATTGACAACATTCTTGCCTTCCCTCCAACACAAACTTCTTCG
Triticum aestivum genome assembly, chromosome: 6A.
LR865515.1:106746358-106746372
AACCCCTTTACTTTGAAGCTCACATAATCT106746358TTCATTGACAACATTTAGTATGCAAAATAGGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR865516.1:177211605-177211619
AACCCCTTTAGTTTGAACTTAACACAATCT177211605TTCATTGACAACATTCAGTATGTAAAATAAGTATAATCCGAATGT
Triticum aestivum genome assembly, chromosome: 6B.
LR865516.1:177254955-177254969
GAACCCTTTACTTTGAAGCTCACATAATCT177254955TTCATTGACAACATTTAGTATGCAAAATAAGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR865516.1:672746913-672746927
CCCTTCTCTGTCACCACAGTTCTACAAGAA672746913TTCATTGACAACATTTTCAAATTGCATGGCATGCCAGTGTCTATG
Triticum aestivum genome assembly, chromosome: 7A.
LR865518.1:11941577-11941591
TGAACTGATCACCATTTTATTATTCATATT11941577TTCATTGACAACATTCAAAACTGAAAGTGTCTCTTCACGGATGTT
Triticum aestivum genome assembly, chromosome: 7B.
LR865519.1:194569894-194569908
CCGTGTATAGTCGTCTTCCGATGGCTGTCG194569894TTCATTGACAACATTGAACATGCTGCGCTGAGAGCACCAAGGCGG
Triticum aestivum genome assembly, chromosome: 7B.
LR865519.1:619692797-619692811
TGATTGTTTTCAGGTTTATGTATGTATTGT619692797TTCATTGACAACATTCCTCAAATATCAGGTAGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR865519.1:619733837-619733851
TGATTGTTTTCAGGTTTATGTATGTATTGT619733837TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR865519.1:619766008-619766022
TGATTGTTTTCAGGTTTATGTATGTATTGT619766008TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR865519.1:691575042-691575056
TACTGGTATGGCTTACTTTTGCGCCCCCAT691575042TTCATTGACAACATTCAGGTGGACCACATATGCAACCGAGCCTTG
Triticum aestivum genome assembly, chromosome: 1D.
LR865762.1:58944723-58944737
CCACGTACAGTACTCTTCCGATGGAAGTCG58944723TTCATTGACAACATTGACCACGCCGCGCTGAGAGCACCAGGGTGG
Triticum aestivum genome assembly, chromosome: 2B.
LR865764.1:308223762-308223776
CAGAGCGCACAGTTAAACCCGGTCTGGTAA308223762TTCATTGACAACATTCACAACAACCGATGGTTATGCATCTAAATG
Triticum aestivum genome assembly, chromosome: 2B.
LR865764.1:490459793-490459807
AGCCATTGTCGGTGAAGTGGCGTCGTATTC490459793TTCATTGACAACATTCGCAACAACAGTTGCAGCCGAAGATGAATA
Triticum aestivum genome assembly, chromosome: 3A.
LR865766.1:124414741-124414755
GAAATGATCACCCATTTTATTATACAACTT124414741TTCATTGACAACATTCATAACTAAAAAGCGTCTCTTCACTGATGT
Triticum aestivum genome assembly, chromosome: 3A.
LR865766.1:380647385-380647399
CCGTATATAGTCGTCTTTCGATGGCTGTCA380647385TTCATTGACAACATTGACAACGCCGCACCGAGAGCACCAAGGCGG
Triticum aestivum genome assembly, chromosome: 3A.
LR865766.1:660860668-660860682
CCGTGTACAGTCGTCTTCCGATGGATGTCG660860668TTCATTGACAACATTGACCACGCCGTGCCGATAGCACTAAGGCGG
Triticum aestivum genome assembly, chromosome: 3B.
LR865767.1:128556253-128556267
AAAGTAGCCCGCTGGTCTGCTCTGTACCAG128556253TTCATTGACAACATTCTGTACAGAAAAAGGCCGAATGGAGTGAAA
Triticum aestivum genome assembly, chromosome: 3B.
LR865767.1:570162236-570162250
AAAGTAGCCCGCCGGTCTGCCCTGTACCAG570162236TTCATTGACAACATTCTGTATAGAAGAAGACCAAATGGAGTGAAA
Triticum aestivum genome assembly, chromosome: 4B.
LR865770.1:157529520-157529534
AAAGTAGCCCGACGGTCTGCCCTGTACCAG157529520TTCATTGACAACATTCTATACAGAAAAAGGCCAAACGGAGTGAGA
Triticum aestivum genome assembly, chromosome: 4B.
LR865770.1:197531625-197531639
AAAGTATCTCGTCGGTCCGCCATGTACCAG197531625TTCATTGACAACATTCTGTACAGAAAAAGAACGAATGGTGTGAAA
Triticum aestivum genome assembly, chromosome: 4B.
LR865770.1:245846414-245846428
CCGCGTACAATAATCTTTCGATGGCTGTCG245846414TTCATTGACAACATTGACCACACCACTCCGACAACACCCAGGTGG
Triticum aestivum genome assembly, chromosome: 4B.
LR865770.1:309020904-309020918
AGAGTAGCCCGCCAGTCTACTCTATACCAG309020904TTCATTGACAACATTCTGTACAGAAAAAGACCAAATGGAGTGAAA
Triticum aestivum genome assembly, chromosome: 4B.
LR865770.1:426093626-426093640
CCACGTACAGTCCACGTCCGATGGATGTCA426093626TTCATTGACAACATTGACCAGGCTGCACCGAGAGCACCATGGCGG
Triticum aestivum genome assembly, chromosome: 5A.
LR865772.1:655964221-655964235
TCTCCAGATTGTACAGCTGCAGCAAATTGA655964221TTCATTGACAACATTCTAATTAGTTTCATGCAACACCGTTTGCAG
Triticum aestivum genome assembly, chromosome: 5B.
LR865773.1:349023734-349023748
AAAGTAGCCCGCCGGTCTGCCCTGTATCAG349023734TTCATTGACAACATTCTATACAGAAAAATACCGAACGGGGTGAAA
Triticum aestivum genome assembly, chromosome: 6A.
LR865775.1:62697055-62697069
TACCATCCTTGCCCATCAATGATTTGTGTT62697055TTCATTGACAACATTCTTGCCTTCCCTCCAACACAAACTTCTTCG
Triticum aestivum genome assembly, chromosome: 6A.
LR865775.1:106252567-106252581
AACCCCTTTACTTTGAAGCTCACATAATCT106252567TTCATTGACAACATTTAGTATGCAAAATAGGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR865776.1:172717199-172717213
AACCCCTTTAGTTTGAACTTAACACAATCT172717199TTCATTGACAACATTCAGTATGTAAAATAAGTATAATCCGAATGT
Triticum aestivum genome assembly, chromosome: 6B.
LR865776.1:172760385-172760399
GAACCCTTTACTTTGAAGCTCACATAATCT172760385TTCATTGACAACATTTAGTATGCAAAATAAGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR865776.1:641101547-641101561
CCCTTCTCTGTCACCACAGTTCTACAAGAA641101547TTCATTGACAACATTTTCAAATTGCATGGCATGCCAGTGTCTATG
Triticum aestivum genome assembly, chromosome: 7B.
LR865779.1:838905690-838905704
TGATTGTTTTCAGGTTTATGTATGTATTGT838905690TTCATTGACAACATTCCTCAAATATCAGGTAGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR865779.1:838946725-838946739
TGATTGTTTTCAGGTTTATGTATGTATTGT838946725TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR865779.1:838978896-838978910
TGATTGTTTTCAGGTTTATGTATGTATTGT838978896TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7D.
LR865780.1:4167811-4167825
GAACTGATCACCCATTTTATTATACATCTT4167811TTCATTGACAACATTCAAAACTGAAAGCGTCTCTTCACGGATGTT
Triticum aestivum genome assembly, chromosome: 7D.
LR865780.1:562154665-562154679
CCATAAGCAGAAAACCAAAGACTGTCCCCC562154665TTCATTGACAACATTGCTTCCGATGAGTCGGTTTGAACAATGATA
Triticum aestivum genome assembly, chromosome: 1A.
LR877309.1:398509944-398509958
CCATGTACAGTACTCTTCCGACAGAAGTCG398509944TTCATTGACAACATTGACCACGCCATGCCAAGAGCACCAGGGCGG
Triticum aestivum genome assembly, chromosome: 1D.
LR877311.1:61895411-61895425
CCACGTACAGTACTCTTCCGATGGAAGTCG61895411TTCATTGACAACATTGACCACGCCGCGCTGAGAGCACCAGGGTGG
Triticum aestivum genome assembly, chromosome: 2B.
LR877313.1:141760644-141760658
TATGATCTATATAAATATTATCACTTAAAA141760644TTCATTGACAACATTTCTTAAGAAAAGCAAATTATCCATTCACAA
Triticum aestivum genome assembly, chromosome: 2B.
LR877313.1:303987277-303987291
CAGAGCGCACAGTTAAACCCGGTCTGGTAA303987277TTCATTGACAACATTCACAACAACCGATGGTTATGCATCTAAATG
Triticum aestivum genome assembly, chromosome: 2B.
LR877313.1:486993182-486993196
AGCCATTGTCGGTGAAGTGGCGTCGTATTC486993182TTCATTGACAACATTCACAACAACAGTTGCAGCCGAAGATGAATA
Triticum aestivum genome assembly, chromosome: 3A.
LR877315.1:125512626-125512640
GAAATGATCACCCATTTTATTATACAACTT125512626TTCATTGACAACATTCATAACTAAAAAGCGTCTCTTCACTGATGT
Triticum aestivum genome assembly, chromosome: 3A.
LR877315.1:664050601-664050615
CCGTGTACAGTCGTCTTCCGATGGATGTCA664050601TTCATTGACAACATTGACCACGCCGTGCCGATAGCACTAAGGCGG
Triticum aestivum genome assembly, chromosome: 3B.
LR877316.1:131363429-131363443
AAAGTAGCCCGCTGGTCTGCTCTGTACCAG131363429TTCATTGACAACATTCTGTACAGAAAAAGGCCGAATGGAGTGAAA
Triticum aestivum genome assembly, chromosome: 3B.
LR877316.1:582929750-582929764
AAAGTAGCCCGTCGGTCTGCCCTGTACCAG582929750TTCATTGACAACATTCTTCATAGAAGAAGACCAAATGGAGTGAAA
Triticum aestivum genome assembly, chromosome: 4B.
LR877319.1:160960092-160960106
AAAGTAGCCCGACGGTCTGCCCTGTACCAG160960092TTCATTGACAACATTCTATACAGAAAAAGGCCAAACGGAGTGAGA
Triticum aestivum genome assembly, chromosome: 4B.
LR877319.1:201010768-201010782
AAAGTATCTCGTCGGTCCGCCATGTACCAG201010768TTCATTGACAACATTCTGTATAGAAAAAGAACGAATGGTGTGAAA
Triticum aestivum genome assembly, chromosome: 4B.
LR877319.1:338915876-338915890
CCGCGTACAATAATCTTTCGATGGCTGTCG338915876TTCATTGACAACATTGACCACACCACTCCGACAACACCCAGGTGG
Triticum aestivum genome assembly, chromosome: 4B.
LR877319.1:347393994-347394008
GAAATGATCACCCATTTTATTATACTACTT347393994TTCATTGACAACATTCATAACTAAAAAGCGTCTCTTCACTGATGT
Triticum aestivum genome assembly, chromosome: 4B.
LR877319.1:444956770-444956784
CCACGTACAGTCCACGTCCGATGGATGTCA444956770TTCATTGACAACATTGACCAGGCTGCACCGAGAGCACCATGGCGG
Triticum aestivum genome assembly, chromosome: 5A.
LR877321.1:667531547-667531561
TCTCCAGATTGTACAGCTGCAGCAAATTGA667531547TTCATTGACAACATTCTAATTAGTTTCATGCAACACCGTTTGCAG
Triticum aestivum genome assembly, chromosome: 5B.
LR877322.1:549119878-549119892
AAAGTAGCCCGCTGGTCTGCTTTGTATCAA549119878TTCATTGACAACATTTTGTACAGAAGGAGACCGAATGGGGTGAAA
Triticum aestivum genome assembly, chromosome: 6A.
LR877324.1:42395789-42395803
CTATATAATGGTGGCCAGAGCACATGTTAT42395789TTCATTGACAACATTAGGCATGGCAAACATCAGAAAGAGTGCAAG
Triticum aestivum genome assembly, chromosome: 6A.
LR877324.1:106622232-106622246
AACCCCTTTACTTTGAAGCTCACATAATCT106622232TTCATTGACAACATTTAGTATGCAAAATAGGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR877325.1:175470040-175470054
AACCCCTTTAGTTTGAACTTAACACAATCT175470040TTCATTGACAACATTCAGTATGTAAAATAAGTATAATCCGAATGT
Triticum aestivum genome assembly, chromosome: 6B.
LR877325.1:175513458-175513472
GAACCCTTTACTTTGAAGCTCACATAATCT175513458TTCATTGACAACATTTAGTATGCAAAATAAGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR877325.1:595932894-595932908
AAAGTAGCCCGTTGGTCTGCCATGTATCAG595932894TTCATTGACAACATTCTGTACAGAAAAAGACTAAACGGTGTGAAA
Triticum aestivum genome assembly, chromosome: 6B.
LR877325.1:650407131-650407145
CCCTTCTCTGTCACCACAGTTCTACAAGAA650407131TTCATTGACAACATTTTCAAATTGCATGGCATGCCAGTGTCTATG
Triticum aestivum genome assembly, chromosome: 7B.
LR877328.1:196067732-196067746
CCGTGTATAGTCGTCTTCCGATGGCTGTCG196067732TTCATTGACAACATTGAACATGCTGCGCTGAGAGCACCAAGGCGG
Triticum aestivum genome assembly, chromosome: 7B.
LR877328.1:626581708-626581722
TGATTGTTTTCAGGTTTATGTATGTATTGT626581708TTCATTGACAACATTCCTCAAATATCAGGTAGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR877328.1:626654854-626654868
TGATTGTTTTCAGGTTTATGTATGTATTGT626654854TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 6A.
LR878450.1:67173215-67173229
TACCATCCTTGCCCATCAATGATTTGTGTT67173215TTCATTGACAACATTCTTGCCTTCCCTCCAACACAAACTTCTTCG
Triticum aestivum genome assembly, chromosome: 6A.
LR878450.1:110652380-110652394
AACCCCTTTACTTTGAAGCTCACATAATCT110652380TTCATTGACAACATTTAGTATGCAAAATAGGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR878451.1:169969901-169969915
AACCCCTTTAGTTTGAACTTAACACAATCT169969901TTCATTGACAACATTCAGTATGTAAAATAAGTATAATCCGAATGT
Triticum aestivum genome assembly, chromosome: 6B.
LR878451.1:170013349-170013363
GAACCCTTTACTTTGAAGCTCACATAATCT170013349TTCATTGACAACATTTAGTATGCAAAATAAGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR878451.1:659402578-659402592
CCCTTCTCTGTCACCACAGTTCTACAAGAA659402578TTCATTGACAACATTTTCAAATTGCATGGCATGCCAGTGTCTATG
Triticum aestivum genome assembly, chromosome: 7B.
LR878454.1:196092722-196092736
CCGTGTATAGTCGTCTTCCGATGGCTGTCG196092722TTCATTGACAACATTGAACATGCTGCGCTGAGAGCACCAAGGCGG
Triticum aestivum genome assembly, chromosome: 7B.
LR878454.1:623238333-623238347
TGATTGTTTTCAGGTTTATGTATGTATTGT623238333TTCATTGACAACATTCCTCAAATATCAGGTAGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR878454.1:623279275-623279289
TGATTGTTTTCAGGTTTATGTATGTATTGT623279275TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR878454.1:623311431-623311445
TGATTGTTTTCAGGTTTATGTATGTATTGT623311431TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR878454.1:693063682-693063696
TACTGGTATGGCTTACTTTTGCGCCCCCAT693063682TTCATTGACAACATTCAGGTGGACCACATATGCAACCGAGCCTTG
Triticum aestivum genome assembly, chromosome: 7D.
LR878455.1:3623378-3623392
GAACTGATCACCCATTTTATTATACATCTT3623378TTCATTGACAACATTCAAAACTGAAAGCGTCTCTTCACGGATGTT
Triticum aestivum genome assembly, chromosome: 7D.
LR878455.1:562053068-562053082
CCATAAGCAGAAAACCAAAGACTGTCCCCC562053068TTCATTGACAACATTGCTTCCGATGAGTCGGTTTGAACAATGATA
Arabidopsis thaliana genome assembly, chromosome: 5.
LR881470.1:2852717-2852731
CGTGATGCTGAAGGCCAAGATGTCTTGCTT2852717TTCATTGACAACATTTTCCGTTTCACTCAGGTAAGCCTTGTTATG
Zea mays genome assembly, chromosome: 2.
LR897968.1:15470526-15470540
CTTCCTTTTAGAAACAGGTCTACGCGAACT15470526TTCATTGACAACATTTGCATATATATATATATATATATATTCATT
Zea mays genome assembly, chromosome: 2.
LR897968.1:90589227-90589241
ATGCCCGAGTTGGATAAATTTGTGGTGGTC90589227TTCATTGACAACATTTTGATCTATTCCAAAAATGAAGAGGAGCAT
Zea mays genome assembly, chromosome: 2.
LR897968.1:131381833-131381847
ATGCCAGAGCTGGACAAGTTTGTGGTGGTT131381833TTCATTGACAACATTCTGGTTTATTCCAAAAATGAAGCTGAGCAT
Zea mays genome assembly, chromosome: 2.
LR897968.1:136020322-136020336
ATGGAATATCTTGATAAGTTTGTTGTGGTA136020322TTCATTGACAACATTCTGATCTATTCCAAAAATGATGGAGAAAAT
Zea mays genome assembly, chromosome: 2.
LR897968.1:193501222-193501236
AGCATTTAAAGCATGATAAATTGTAGAAGG193501222TTCATTGACAACATTTCTCCTAGGCATATGAACAACATTTCTACC
Zea mays genome assembly, chromosome: 3.
LR897969.1:95535044-95535058
ATGCCCGAGTTGGATAAATTTGTGGTGGTC95535044TTCATTGACAACATTCTGATCTATTCCAAAGATGAAGAGGAGCAT
Zea mays genome assembly, chromosome: 3.
LR897969.1:202350854-202350868
CTCGACACCCCTGTCAATGTGAGGGAGGTC202350854TTCATTGACAACATTTCTCACATACATCATTATCGGGACAATATT
Zea mays genome assembly, chromosome: 4.
LR897970.1:52447341-52447355
TTTTTACTACACCAGTTGTAGATTGATCGA52447341TTCATTGACAACATTGGCTGTCATTGTAAAAGGGCAAAGCAGTAG
Zea mays genome assembly, chromosome: 6.
LR897972.1:58834125-58834139
ATGCTCGAGTTAGACAAGTTTGTGGTGGTA58834125TTCATTGACAACATTCTGATCTATTCCAAAAATGAAGAGGAGCAT
Zea mays genome assembly, chromosome: 7.
LR897973.1:47719302-47719316
ATGGAAGAGTTAGATAAGTTTGTCGTAGTC47719302TTCATTGACAACATTCTCATCTACTCCAAGAGTCAACAGGAGCAT
Zea mays genome assembly, chromosome: 7.
LR897973.1:131161933-131161947
CCTAATAGCAAATTCCGTGTTCCACATCAT131161933TTCATTGACAACATTCATCAACTCTTGAATGGAAGCCTTCTCTCT
Zea mays genome assembly, chromosome: 10.
LR897976.1:31872158-31872172
TTCATCGAGCTGGATAAATTTGTGGTGGTT31872158TTCATTGACAACATTCTTATCTATTCCAAAAATGAAGAGGAGCAT
Zea mays genome assembly, chromosome: 10.
LR897976.1:66590088-66590102
AAGCCCGAATTAGACAAGTTTGTGGTGGTC66590088TTCATTGACAACATTTTGATCTATTCCAAGAATGAGGAGGAGCAT
Zea mays genome assembly, chromosome: 10.
LR897976.1:76163041-76163055
ATGGACTATCTCGATAAGTTTGTGGTGGTA76163041TTCATTGACAACATTCTGATTTATTCTCAAAGCGAAGAAGAGCAT
Triticum aestivum genome assembly, chromosome: II.
LS480641.1:34292335-34292349
ATGAAATTCATGGACAAATTTGTGGTGGTA34292335TTCATTGACAACATTCTGGTTTACTCGAGGACACCAGAAGAGCAT
Musa schizocarpa genome assembly, chromosome: S01.
LS990915.1:24254403-24254417
TAACACTTTTACACAATTTATCAATTCAGA24254403TTCATTGACAACATTTCATTTCATACAAAATGCACTTATACAACA
Musa schizocarpa genome assembly, chromosome: S01.
LS990915.1:24884899-24884913
TAACACTTTTACACAGTATATCCATTTCGA24884899TTCATTGACAACATTTCATTACATACAAAATATGCTTATACAACA
Musa schizocarpa genome assembly, chromosome: S03.
LS990917.1:39558586-39558600
TGAGTAAAAGTAGTTCCCAGTAACAGTCAT39558586TTCATTGACAACATTGATTCCATAAATTTTGCTTCTTTCTCAGTG
Musa schizocarpa genome assembly, chromosome: S07.
LS990920.1:13283344-13283358
TAACACTTTTACAAGGTATATCGATTTTGG13283344TTCATTGACAACATTTCATTACATACAAAATATGCTTATACAACA
Musa schizocarpa genome assembly, chromosome: S08.
LS990922.1:49438605-49438619
AGGTTATTAGTATCCAAAATTTCCATGTCA49438605TTCATTGACAACATTTCTTATGGTTTATAGCACATTGATGATTAA
Musa schizocarpa genome assembly, chromosome: S09.
LS990923.1:35277004-35277018
TAACACTTTTACACAGTATATCCATTTTGA35277004TTCATTGACAACATTTCATTACATACAAAATATGCTTATACAACA
Triticum aestivum genome assembly, chromosome: 1B.
LS992081.1:232769732-232769746
AACGTAGTCCATTGGTCTGCCATGTATCAG232769732TTCATTGACAACATTCTGTACAGAAAAAGACCAAATGGTGTGAAA
Triticum aestivum genome assembly, chromosome: 1B.
LS992081.1:315151006-315151020
AAAGTAGTCCATCGGTCTGCCCTATACCAG315151006TTCATTGACAACATTCTATACAGAAAAAGACTAAACAAAGTGAAA
Triticum aestivum genome assembly, chromosome: 1D.
LS992082.1:60491964-60491978
CCACGTACAGTACTCTTCCGATGGAAGTCG60491964TTCATTGACAACATTGACCACGCCGCGCTGAGAGCACCAGGGTGG
Triticum aestivum genome assembly, chromosome: 2B.
LS992084.1:142852677-142852691
TATGATCTATATAAATATTATCACTTAAAA142852677TTCATTGACAACATTTCTTAAGAAAAGCAAATTATCCATTCACAA
Triticum aestivum genome assembly, chromosome: 2B.
LS992084.1:302471582-302471596
CAGAGCGCACAGTTAAACCCGGTCTGGTAA302471582TTCATTGACAACATTCACAACAACCGATGGTTATGCATCTAAATG
Triticum aestivum genome assembly, chromosome: 2B.
LS992084.1:488480650-488480664
AGCCATTGTCGGTGAAGTGGCGTCGTATTC488480650TTCATTGACAACATTCGCAACAACAGTTGCAGCCGAAGATGAATA
Triticum aestivum genome assembly, chromosome: 2B.
LS992084.1:578829189-578829203
AGCCATGGTCGGTGAAGTGGCGTCGTCTTC578829189TTCATTGACAACATTCGCAACAACAGTTGCAGCTGAAGATGAATA
Triticum aestivum genome assembly, chromosome: 3A.
LS992086.1:666833082-666833096
CCGTGTACAGTCGTCTTCCGATGGATGTCG666833082TTCATTGACAACATTGACCACGCCGTGCCGATAGCACTAAGGCGG
Triticum aestivum genome assembly, chromosome: 3B.
LS992087.1:378138404-378138418
GAAACATGGTCATCATATGTTACGGCATTT378138404TTCATTGACAACATTGACATGTGAGTTCATTTTTAAGTTAATGGA
Triticum aestivum genome assembly, chromosome: 3B.
LS992087.1:569152033-569152047
AAAGTAGCCCGCCGGTCTGCCCTGTACCAG569152033TTCATTGACAACATTCTGTATAGAAGAAGACCAAATGGAGTGAAA
Triticum aestivum genome assembly, chromosome: 4B.
LS992090.1:158465101-158465115
AAAGTAGCCCGACGGTCTGCCCTGTACCAG158465101TTCATTGACAACATTCTATACAGAAAAAGGCCAAACGGAGTGAGA
Triticum aestivum genome assembly, chromosome: 4B.
LS992090.1:198512804-198512818
AAAGTATCTCGTCGGTCCGCCATGTACCAG198512804TTCATTGACAACATTCTGTACAGAAAAAGAACGAATGGTGTGAAA
Triticum aestivum genome assembly, chromosome: 4B.
LS992090.1:247849017-247849031
CCGCGTACAATAATCTTTCGATGGCTGTCG247849017TTCATTGACAACATTGACCACACCACTCCGACAACACCCAGGTGG
Triticum aestivum genome assembly, chromosome: 4B.
LS992090.1:256327366-256327380
GAAATGATCACCCATTTTATTATACTACTT256327366TTCATTGACAACATTCATAACTAAAAAGCGTCTCTTCACTGATGT
Triticum aestivum genome assembly, chromosome: 4B.
LS992090.1:314029397-314029411
AGAGTAGCCCGCCAGTCTACTCTATACCAG314029397TTCATTGACAACATTCTGTACAGAAAAAGACCAAATGGAGTGAAA
Triticum aestivum genome assembly, chromosome: 4B.
LS992090.1:432521930-432521944
CCACGTACAGTCCACGTCCGATGGATGTCA432521930TTCATTGACAACATTGACCAGGCTGCACCGAGAGCACCATGGCGG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ddbj122pln/TTCATTGACAACATT
lang : en | db : ddbj122pln | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.176 | 0.169 | search_plus_done; http://172.18.8.71:27587/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.454 | 0.278 | search_minus_done; http://172.18.8.71:27587/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=0
0.454 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).