GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-04-18 13:47:53, GGGenome : DDBJ release 125.0, EST division (Dec, 2021)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

97MJ0212 Rice Immature Seed Lambda ZAPII cDNA Library Oryza sativa Indica Group cDNA clone 97MJ0212, mRNA sequence.
AA754308.1:217-231
TATGATTGAGCACCCCTACCTACTTTGCAA217AATGTTGTCAATGAACTGTTTGTTCGCTAAAAAAAAAAAA
EST243161 tomato ovary, TAMU Solanum lycopersicum cDNA clone cLED3N9, mRNA sequence.
AI484898.1:589-603
GAGATCATTTACACAAGGACATGGCAAGAA589AATGTTGTCAATGAATTATTTTAGCTTAGAGTCAATTATTTTGTT
EST255660 tomato resistant, Cornell Solanum lycopersicum cDNA clone cLER12N17, mRNA sequence.
AI774560.1:400-414
GAGATCATTTACACAAGGACATGGCAAGAA400AATGTTGTCAATGAATTATTTTAGCTTAGAGTCAATTATTTTGTT
EST260558 tomato susceptible, Cornell Solanum lycopersicum cDNA clone cLES8F8, mRNA sequence.
AI779679.1:352-366
GAGATCATTTACACAAGGACATGGCAAGAA352AATGTTGTCAATGAATTATTTTAGCTTAGAGTCAATTATTTTGTT
Gerbera hybrid cv. 'Terra Regina' EST, clone G0000400019G10F1.
AJ759470.1:150-164
TTGCATGAAAAGCTTCATGCATTTCCACTT150AATGTTGTCAATGAAGCGTTACCACCAAGTATTGTGTATTGTTTC
Gerbera hybrid cv. 'Terra Nero' EST, clone G0000900010G05F1.
AJ766556.1:176-190
TTGCATGAAAAGCTTCATGCATTTCCACTT176AATGTTGTCAATGAAGCGTTACCACCAAGTATTGTGTATTGTTTC
Trichoderma atroviride EST, clone L51TP1P018R01724.
AJ913629.1:366-380
CACCTCAGAACCGGCCTGGGTGAATCGGAA366AATGTTGTCAATGAAGAGCAGGACTGTGAATGAGATGTTAG
Bos indicus 5' EST, clone C0006008g11.
AM036479.1:11-25
TGGAGTAAGG11AATGTTGTCAATGAAGAGGCTCCCCCCACATCCCTGTCCCCTTCG
Paracentrotus lividus EST, clone MPMGp1173M061Q, 5' end.
AM562411.1:345-359
GAGAAGCATGTACAAATCCAAAACGTTACA345AATGTTGTCAATGAATATTTAATTCTACTTAACAAATGCTATATG
Clytia hemisphaerica EST, 5' end sequence, clone IL0ABA6YE20RM1.
AM753499.1:608-622
TACCTCAGAACCAGCTTGAGTAAATCTGAA608AATGTTGTCAATGAAAAGCAATACATCTTGTCCTTCCACGTCACG
Oryza sativa Japonica Group cDNA, partial sequence (E31184_6Z).
AU029645.1:433-447
TATGATTGAGCACCCCTACCTACTTTGCAA433AATGTTGTCAATGAACTGTTTGTTCGCTACATAAATGTTCAATGA
Oryza sativa Japonica Group cDNA, partial sequence (E60206_2Z).
AU030764.2:561-575
TATGATTGAGCACCCCTACCTACTTTGCAA561AATGTTGTCAATGAACTGTTTGTTCGCTACATAAATGTTCAATGA
Oryza sativa Japonica Group cDNA, partial sequence (E60346_2Z).
AU030852.1:446-460
TATGATTGAGCACCCCTACCTACTTTGCAA446AATGTTGTCAATGAACTGTTTGTTCGCTACATAAATGTTCAATGA
Oryza sativa Japonica Group cDNA, partial sequence (E60362_2Z).
AU030868.1:267-281
TATGATTGAGCACCCCTACCTACTTTGCAA267AATGTTGTCAATGAACTGTTTGTTCGCTACATAAATGTTCAATGA
Oryza sativa Japonica Group cDNA, partial sequence (S11896_6Z).
AU032618.1:352-366
TATGATTGCCCCCCCCTACCTACTTTGCAA352AATGTTGTCAATGAACTGTTTGTTCGCTAAAAAAAAAAAAAAAAA
Oryza sativa Japonica Group cDNA, partial sequence (S20935_2Z).
AU056865.1:620-634
TATGATTGAGCACCCCTACCTACTTTGCAA620AATGTTGTCAATGAACTGTTTGTTCGCTACATAAATGTTCAATGA
Oryza sativa Japonica Group cDNA, partial sequence (S16215_1A).
AU065967.2:345-359
TATGATTGAGCACCCCTACCTACTTTGCAA345AATGTTGTCAATGAACTGTTTGTTCGCTACATAAATGTTCAATGA
Oryza sativa Japonica Group cDNA, partial sequence (S14963_8Z).
AU075521.1:239-253
TATGATTGAGCACCCCTACCTACTTTGCAA239AATGTTGTCAATGAACTGTTTGTTCGCTAAAAAAAAAAAAAAAAA
Oryza sativa Japonica Group cDNA, partial sequence (E60915_4Z).
AU083006.1:413-427
TATGATTGAGCACCCCTACCTACTTTGCAA413AATGTTGTCAATGAACTGTTTGTTCGCTAAAAAAAAAAAAAAAAA
Oryza sativa Japonica Group cDNA, partial sequence (S11818_10Z).
AU083019.1:663-677
TATGATTGAGCACCCCTACCTACTTTGCAA663AATGTTGTCAATGAACTGTTTGTTCGCTAAAAAAAAAAAAAAAAA
Oryza sativa Japonica Group cDNA, partial sequence (S2589_20Z).
AU108310.1:195-209
TATGATTGAGCACCCCTACCTACTTTGCAA195AATGTTGTCAATGAACTGTTTGTTCGCTACATAAATGTTCAATGA
Oryza sativa Japonica Group cDNA, partial sequence (E1291_98Z).
AU182252.1:368-382
TATGATTGAGCACCCCTACCTACTTTGCAA368AATGTTGTCAATGAACTGTTTGTTCTGCTACATAAATGTTCAATG
Oryza sativa Japonica Group cDNA, partial sequence (E2149_96Z).
AU182339.1:412-426
TATGATTGAGCACCCCTACCTACTTTGCAA412AATGTTGTCAATGAACTGTTTGTTCGCTACATAAAAAAAAAAAAA
Oryza sativa Japonica Group cDNA, partial sequence (E51089_96Z).
AU183223.1:355-369
TATGATTGAGCACCCCTACCTACTTTGCAA355AATGTTGTCAATGAACTGTTTGTTCGCTACATAAATGTTCAATGA
Oryza sativa Japonica Group cDNA, partial sequence (S0017_97Z).
AU222686.1:270-284
TATGATTGAGCACCCCTACCTACTTTGCAA270AATGTTGTCAATGAACTGTTTGTTCGCTACATAAATGTTCAATGA
Oryza sativa Japonica Group cDNA, partial sequence (S0692_98Z).
AU222748.1:402-416
TATGATTGAGCACCCCTACCTACTTTGCAA402AATGTTGTCAATGAACTGTTTGTTCGCTAAAAAAAAAAAAAAAAA
Oryza sativa Japonica Group cDNA, partial sequence (S4822_98Z).
AU223195.1:405-419
TATGATTGAGCACCCCTACCTACTTTGCAA405AATGTTGTCAATGAACTGTTTGTTCGCTACAAAAAAAAAAAAAAA
Dictyostelium discoideum gamete cDNA clone:FC-AI22, 3' end single read.
AU284293.1:320-334
AGTGATGAATCTCGTCCTGGTTGTATCGTT320AATGTTGTCAATGAAAATGTTTCAACCCTTTTAGATGTTAGAGGA
gb31h03.y1 Moss EST library PPN Physcomitrella patens cDNA clone PEP_SOURCE_ID:PPN140806 5' similar to SW:ARF_ORYSA P51823 ADP-RIBOSYLATION FACTOR, mRNA sequence.
AW699769.1:369-383
TTTGTCTCTCTCCATGCCTTAGATGAGTAT369AATGTTGTCAATGAAATCTGCGCGTCTTATACACGTATCTCATTA
EST332460 KV3 Medicago truncatula cDNA clone pKV3-13M8, mRNA sequence.
AW736446.1:509-523
ATTTTCTGCATCTCTGTCGCGTATGTGGCA509AATGTTGTCAATGAAAACAAAAGGGCAGCAGTATTTGGGTGGATC
gb41a12.y1 Moss EST library PPN Physcomitrella patens cDNA clone PEP_SOURCE_ID:PPN161323 5' similar to SW:ARF1_CATRO O23778 ADP-RIBOSYLATION FACTOR 1, mRNA sequence.
AW739373.1:219-233
TTTGTCTCTCTCCATGCCTTAGATGAGTAT219AATGTTGTCAATGAAATCTGCGCGTCTTATACACGTATCTCATTA
EST343135 potato stolon, Cornell University Solanum tuberosum cDNA clone cSTA5C22, mRNA sequence.
AW907103.1:102-116
TCACAAAATCAAACCAACTATGATGTAGTA102AATGTTGTCAATGAAGAACCTATTGATGAGAACCTGAAACATGTG
Bombyx mori cDNA, clone:E_ET_psgV_10H03_R_0, 3' end sequence.
BB993321.1:745-759
CACTTCTGATCCAGCCTGAGTGAAACGGAA745AATGTTGTCAATGAAGAGCAGTACATCCTGTCCTTCTTGATCACG
UI-R-CA0-axa-c-03-0-UI.s1 UI-R-CA0 Rattus norvegicus cDNA clone UI-R-CA0-axa-c-03-0-UI 3', mRNA sequence.
BE108084.1:348-362
GTATGTGTAGTGGATACAAGGAAGGAAATC348AATGTTGTCAATGAAATGCACATGTGTTGTCACCTACTGGAAAGC
UI-R-CA0-axa-c-04-0-UI.s1 UI-R-CA0 Rattus norvegicus cDNA clone UI-R-CA0-axa-c-04-0-UI 3', mRNA sequence.
BE108085.1:348-362
GTATGTGTAGTGGATACAAGGAAGGAAATC348AATGTTGTCAATGAAATGCACATGTGTTGTCACCTACTGGAAAGC
EST00572 Arabidopsis Chronic Ozone Forward-Subtracted Library Arabidopsis thaliana cDNA clone AtCOzJB5, mRNA sequence.
BE662828.1:568-582
CACTTCAGAGTTGGCCTGAGTGAAACGGAA568AATGTTGTCAATGAAAAGCAAGACATCTTGGCCTTCAGCATCACG
EST443364 potato stolon, Cornell University Solanum tuberosum cDNA clone cSTA38L16 5' sequence, mRNA sequence.
BF187077.1:117-131
GGTTCTAATCAGCTCAAGTTTTGGAAAGAA117AATGTTGTCAATGAAATGCCTCAAGCTCTTGTTTCTAAATTATCT
UI-R-CN0-bmf-g-07-0-UI.s1 UI-R-CN0 Rattus norvegicus cDNA clone UI-R-CN0-bmf-g-07-0-UI 3', mRNA sequence.
BF410934.1:349-363
GTATGTGTAGTGGATACAAGGAAGGAAATC349AATGTTGTCAATGAAATGCACATGTGTTGTCACCTACTGGAAAGC
3166-90 hindgut and Malpighian tubule subtracted cDNA library Ctenocephalides felis cDNA clone 3166-90, mRNA sequence.
BF731994.1:95-109
TACTTCAGAACCGGCTTGAGTGAAACGGAA95AATGTTGTCAATGAAAAGAAGT
NXSI_070_C12_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA clone NXSI_070_C12 5' similar to Arabidopsis thaliana sequence At5g08680 H+-transporting ATP synthase beta chain (mitochondrial) -li
BF777593.1:253-267
CACTTCNNAGTTTGCTTGTGTAAAACGNNN253AATGTTGTCAATGAAGAGCAACACATCCTGGCCTTCGGCATCTCG
EST461516 potato leaves and petioles Solanum tuberosum cDNA clone cSTB45F5 5' sequence, mRNA sequence.
BG096997.1:52-66
TCACAAAATCAAACCAACTATGATGTAGTA52AATGTTGTCAATGAAGAACCTATTGATGAGAACCTGAAACATGTG
EST476672 wild tomato pollen Solanum pennellii cDNA clone cLPP2C19 5' sequence, mRNA sequence.
BG136230.1:276-290
AATTGTACATCAAACAACAACATTGTTGTA276AATGTTGTCAATGAATTAGATGAACCATTTCTAATTACATGGAAA
EST476776 wild tomato pollen Solanum pennellii cDNA clone cLPP2G20 5' sequence, mRNA sequence.
BG136334.1:273-287
AATTGTACATCAAACAACAACATTGTTGTA273AATGTTGTCAATGAATTAGATGAACCATTTCTAATTACATGGAAA
EST477055 wild tomato pollen Solanum pennellii cDNA clone cLPP3K21 5' sequence, mRNA sequence.
BG136517.1:274-288
AATTGTACATCAAACAACAACATTGTTGTA274AATGTTGTCAATGAATTAGATGAACCATTTCTAATTACATGGAAA
EST476973 wild tomato pollen Solanum pennellii cDNA clone cLPP2L24 5' sequence, mRNA sequence.
BG136615.1:272-286
AATTGTACATCAAACAACAACATTGTTGTA272AATGTTGTCAATGAATTAGATGAACCATTTCTAATTACATGGAAA
EST477402 wild tomato pollen Solanum pennellii cDNA clone cLPP4I22 5' sequence, mRNA sequence.
BG136960.1:272-286
AATTGTACATCAAACAACAACATTGTTGTA272AATGTTGTCAATGAATTAGATGAACCATTTCTAATTACATGGAAA
EST477657 wild tomato pollen Solanum pennellii cDNA clone cLPP5K5 5' sequence, mRNA sequence.
BG137215.1:272-286
AATTGTACATCAAACAACAACATTGTTGTA272AATGTTGTCAATGAATTAGATGAACCATTTCTAATTACATGGAAA
EST477675 wild tomato pollen Solanum pennellii cDNA clone cLPP5O1 5' sequence, mRNA sequence.
BG137233.1:270-284
AATTGTACATCAAACAACAACATTGTTGTA270AATGTTGTCAATGAATTAGATGAACCATTTCTAATTACATGGAAA
EST477733 wild tomato pollen Solanum pennellii cDNA clone cLPP5M6 5' sequence, mRNA sequence.
BG137291.1:272-286
AATTGTACATCAAACAACAACATTGTTGTA272AATGTTGTCAATGAATTAGATGAACCATTTCTAATTACATGGAAA
EST477878 wild tomato pollen Solanum pennellii cDNA clone cLPP6G5 5' sequence, mRNA sequence.
BG137436.1:272-286
AATTGTACATCAAACAACAACATTGTTGTA272AATGTTGTCAATGAATTAGATGAACCATTTCTAATTACATGGAAA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ddbj125est/AATGTTGTCAATGAA
lang : en | db : ddbj125est | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.510 | 0.502 | search_plus_done; http://172.18.8.74:27714/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.547 | 0.037 | search_minus_done; http://172.18.8.74:27714/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=0
0.547 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).