GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-04-18 14:22:07, GGGenome : DDBJ release 125.0, HTG division (Dec, 2021)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Caenorhabditis elegans clone Y53G8A, *** SEQUENCING IN PROGRESS ***, 3 unordered pieces.
AC006803.2:84457-84471
ACGTATCTCAGCGGGAGAAATAGTTACAAA84457AATGTTGTCAATGAAGTACTTGTAGAGCTCAAAATTTCCTACAAT
Caenorhabditis elegans clone Y53G8X, *** SEQUENCING IN PROGRESS ***, 3 unordered pieces.
AC006871.1:84457-84471
ACGTATCTCAGCGGGAGAAATAGTTACAAA84457AATGTTGTCAATGAAGTACTTGTAGAGCTCAAAATTTCCTACAAT
Drosophila melanogaster, *** SEQUENCING IN PROGRESS ***.
AC014422.1:40909-40923
CACCTCCGATCCCGCCTGGGTGAAACGGAA40909AATGTTGTCAATGAAGAGCAGCACATCCTGCCCGTCCACGTCGCG
Drosophila melanogaster, *** SEQUENCING IN PROGRESS ***.
AC014781.1:63983-63997
TGTTGCGGTGCGCGTACGTGGCGTATACGC63983AATGTTGTCAATGAACCTGCACGGATTATTGGCATTAAGTAAGCC
Homo sapiens chromosome 3 clone RP11-529P9, WORKING DRAFT SEQUENCE, 18 unordered pieces.
AC021156.4:27-41
TGGATATTAAATCTGAAACTTATCCC27AATGTTGTCAATGAACATTGTCAGACATTGGGCAGCATCTCTTAT
Homo sapiens chromosome 3 clone RP11-529P9, WORKING DRAFT SEQUENCE, 18 unordered pieces.
AC021156.4:16960-16974
AATTTGAATATTAATTTTAAAATTTATTCA16960AATGTTGTCAATGAACATTGTCAGACATTTTGCAGCATNNNNNNN
Homo sapiens clone RP11-3F6, WORKING DRAFT SEQUENCE, 23 unordered pieces.
AC021764.4:176688-176702
TCTTCTCAGGCAATATTTGTTGAACGAACC176688AATGTTGTCAATGAAGCTAATGAGCTGACTCAGGCCAGGCACCAC
Homo sapiens clone RP11-25B3, WORKING DRAFT SEQUENCE, 18 unordered pieces.
AC025831.2:25722-25736
AACTAACACCCATAAAAGGTATGACTCTTT25722AATGTTGTCAATGAAGATTTAACATAATATTCTATAACAAATATA
Homo sapiens chromosome 3 clone RP11-72K12, WORKING DRAFT SEQUENCE, 25 unordered pieces.
AC026102.14:162651-162665
GGACTATTATATGACTATATTATAATCTTA162651AATGTTGTCAATGAATATATGTTTCCAATTTCTGGCTATTACAAT
Homo sapiens clone RP11-440O20, WORKING DRAFT SEQUENCE, 15 unordered pieces.
AC061966.2:46507-46521
ATAAGATAGGTTTGTTCCAGAAGTTTAAAA46507AATGTTGTCAATGAATTTGATAAAGTTTAATATTCACATTAAAAG
Homo sapiens chromosome 3 clone RP11-360A12, WORKING DRAFT SEQUENCE, 21 unordered pieces.
AC069422.7:59511-59525
TTAATATTAATATTAAATGGGTGCCCACAA59511AATGTTGTCAATGAAAATCTGTGTTTAAAGCGATAATATATTCTG
Homo sapiens chromosome 3 clone RP11-279L16, WORKING DRAFT SEQUENCE, 30 unordered pieces.
AC069521.12:167663-167677
GGACTATTATATGACTATATTATAATCTTA167663AATGTTGTCAATGAATATATGTTTCCAATTTCTGGCTATTACAAT
Homo sapiens chromosome 8 clone RP11-243G8 map 8, LOW-PASS SEQUENCE SAMPLING.
AC079058.1:9110-9124
TCCTAGGAATGGTAAGGTGTGGTTGATGGT9110AATGTTGTCAATGAATTATCAGGCTTTCCTCAAACGCCTTTCGTT
Homo sapiens chromosome 4 clone RP11-42A22 map 4, WORKING DRAFT SEQUENCE, 23 unordered pieces.
AC079295.2:117225-117239
ACTCACTGGATCCAATCAGCATAATGTCAT117225AATGTTGTCAATGAAAAGAGTTGAACTCTGTAAAATATTTGAAGA
Homo sapiens chromosome 8 clone CTD-386L14 map 8, WORKING DRAFT SEQUENCE, 5 unordered pieces.
AC083759.2:8986-9000
TTTGAAAAAAGAGACACAATAAAACTTAAT8986AATGTTGTCAATGAAAAGTGGAAATATCGATGAATTTAAAAATAC
Felis catus clone RP86-166J10, WORKING DRAFT SEQUENCE, 12 ordered pieces.
AC092518.2:141506-141520
CCAGGGCCAGGGACGCACCTGGGTTCTTGG141506AATGTTGTCAATGAAATCGTCCGGCCTGTGTGTGAGTAGCACTGG
Rattus norvegicus clone CH230-123I24, WORKING DRAFT SEQUENCE, 6 unordered pieces.
AC107525.6:169952-169966
ATACCAAGTAAAAAAACAAAAAAACAAAAA169952AATGTTGTCAATGAAGGTGTGGAAGAAAATTTTCCAAACCTAGTG
Rattus norvegicus clone CH230-134A2, WORKING DRAFT SEQUENCE, 3 unordered pieces.
AC109394.5:108606-108620
ATTTGGAGTTGGGGTCTATAGCTGCCATAG108606AATGTTGTCAATGAAACCTAATGGGTTGTTATGGTGAAAGTTCAG
Homo sapiens chromosome 18 clone RP11-1058P11 map 18, WORKING DRAFT SEQUENCE, 15 ordered pieces.
AC111077.5:69335-69349
TAATTTTTGTTGAGACAAATCTCCCAAGTA69335AATGTTGTCAATGAAATAATATGAAATATATACATATATAAATAT
Rattus norvegicus clone CH230-235J20, WORKING DRAFT SEQUENCE, 2 unordered pieces.
AC111786.5:134443-134457
CCATAGATTAGTCATAGATAGCAGCTACTA134443AATGTTGTCAATGAAGTTTCTACACAAATGGTAATTAGGCAATTT
Rattus norvegicus clone CH230-123E12, WORKING DRAFT SEQUENCE.
AC114513.4:224538-224552
TCTCTTATGTATCCATTGTCCAATTTCTAG224538AATGTTGTCAATGAACTGTGTCTTTGAGGCAGTTTCTTTTTGAGC
Rattus norvegicus clone CH230-81E21, WORKING DRAFT SEQUENCE, 14 unordered pieces.
AC121036.4:139017-139031
ACCTGTTATTTTTTGCATGTCATACAGTTT139017AATGTTGTCAATGAAAAAGTCTATACAGGCAAAAGATTTTGAAAA
Rattus norvegicus clone CH230-110K3, WORKING DRAFT SEQUENCE, 3 unordered pieces.
AC123160.5:33638-33652
AAGGACCTCAACATCAGGCCTGATAGCCTG33638AATGTTGTCAATGAAAGAAACTGCTGTCAGAGGAGTAAGGAATGT
Rattus norvegicus clone CH230-509H12, WORKING DRAFT SEQUENCE.
AC130021.4:166745-166759
AAGGACCTCAACATCAGGCCTGATAGCCTG166745AATGTTGTCAATGAAAGAAACTGCTGTCAGAGGAGTAAGGAATGT
Rattus norvegicus clone CH230-470L15, *** SEQUENCING IN PROGRESS ***, 48 unordered pieces.
AC136076.1:94443-94457
CCATAGATTAGTCATAGATAGCAGCTACTA94443AATGTTGTCAATGAAGTTTCTACACAAATGGTAATTAGGCAATTT
Bos taurus clone RP42-525L10, WORKING DRAFT SEQUENCE, 7 ordered pieces.
AC140963.2:102143-102157
TGTTTATATGTAACAAATTGGAAAACTTCA102143AATGTTGTCAATGAAATCTCTTAGAAACCAATGCAAATATACTTG
Rattus norvegicus clone CH230-519E16, WORKING DRAFT SEQUENCE, 23 unordered pieces.
AC141579.5:164026-164040
CTACTTATTCATTCATGTATGTGGGTTTCA164026AATGTTGTCAATGAACACTGCTGCTTCATCGAACACATGAAAAAT
Bos taurus clone CH240-158B3, WORKING DRAFT SEQUENCE, 2 unordered pieces.
AC151185.3:71654-71668
GCTGGTAGTGGATGAGGTCACACAAAAAGG71654AATGTTGTCAATGAAAGCCAAGAAAACAAACATTAAGAACTTCTA
Dasypus novemcinctus clone VMRC5-372D4, WORKING DRAFT SEQUENCE, 6 ordered pieces.
AC151653.2:18591-18605
AGGGCAGGCTGCAAGCCAGAAACTCCAATG18591AATGTTGTCAATGAATTCGCCTGGAGACACTGGCTGTCTGGAGTA
Bos taurus clone CH240-20F22, WORKING DRAFT SEQUENCE, 21 unordered pieces.
AC153238.3:122576-122590
CAACCACAAGAGATAGGCAGAATTTTCATC122576AATGTTGTCAATGAATAAACTGAAGCAGAGAGAAGTTAAGCAAGA
Zea mays strain B73 clone ZMMBBc0159I16, *** SEQUENCING IN PROGRESS ***, 16 unordered pieces.
AC155550.2:181171-181185
ATGCTCCTCTTTATTTTTGGAATAGATTAG181171AATGTTGTCAATGAAGACCACCACAAACTTATCTAACTCGAGCAT
Bos taurus clone CH240-99G24, WORKING DRAFT SEQUENCE, 3 unordered pieces.
AC162021.3:53920-53934
CTTTATTTTCTTTTGCTACAAAGTGTTCGA53920AATGTTGTCAATGAAATGATTACTTTAAAAAAGGCAGATCATTTA
Mus musculus chromosome 5 clone RP24-135A18, WORKING DRAFT SEQUENCE, 27 unordered pieces.
AC162524.1:491033-491047
TAGCATCCATGCCCCCAAGCCAAAAGCATC491033AATGTTGTCAATGAAACATTACTAAAGTTTAAAGTACATGTTGAC
Bos taurus clone CH240-157A10, WORKING DRAFT SEQUENCE, 67 unordered pieces.
AC164805.2:50470-50484
AAGTATAAGAAAGAGTAGGGTGGTGAAGGG50470AATGTTGTCAATGAACCTAATTCAGGATAGAAGCAGAAGCTCTGG
Bos taurus clone CH240-171I22, WORKING DRAFT SEQUENCE, 5 unordered pieces.
AC165520.3:184233-184247
GAACAGTGGAAACGAGCTATGGATTATTTA184233AATGTTGTCAATGAACTCAACTACATGACTCAGATTGTTATCATG
Bos taurus clone CH240-180A17, WORKING DRAFT SEQUENCE, 20 unordered pieces.
AC166696.3:117345-117359
ACTCAATAACCTGAATTTTTAACAAGCCCA117345AATGTTGTCAATGAATCCATATTCTGACCCAGTAATTACACTTCT
Sorex araneus clone SA_Ba-55E16, WORKING DRAFT SEQUENCE, 3 ordered pieces.
AC167317.2:128228-128242
AACATCCTTCTTTTCACCTGGGGTGACATT128228AATGTTGTCAATGAAATCAAATGTAGTTTCAACCTATCATGCTTT
Bos taurus clone CH240-231N1, WORKING DRAFT SEQUENCE, 5 unordered pieces.
AC169040.3:143767-143781
GATGTGTGGAGGGAATGAAAGAGATTTTTC143767AATGTTGTCAATGAATGTGTAGAGCCCCTGGTTAAAAACATATAT
Strongylocentrotus purpuratus clone R3-4014P23, WORKING DRAFT SEQUENCE, 14 unordered pieces.
AC173353.2:104475-104489
AGATTCATATCCATAACATTTTCAATAATA104475AATGTTGTCAATGAACTGATACGGAAAGCCATAATAGTCTTAGGT
Bos taurus clone CH240-83J17, WORKING DRAFT SEQUENCE, 22 unordered pieces.
AC173825.3:119229-119243
AAGTATAAGAAAGAGTAGGGTGGTGAAGGG119229AATGTTGTCAATGAACCTAATTCAGGATAGAAGCAGAAGCTCTGG
Strongylocentrotus purpuratus clone R3-27C18, WORKING DRAFT SEQUENCE, 18 unordered pieces.
AC178873.1:100931-100945
AGACCTACTGCGTTTGTCATCGATGAAAAA100931AATGTTGTCAATGAAAACATGAAATGAAGTGAAGTAATCTTACCT
Strongylocentrotus purpuratus clone R3-3071C21, WORKING DRAFT SEQUENCE, 21 unordered pieces.
AC180824.1:85771-85785
CATGTGTGTTAAGGATGCCGTAGTCAAGTC85771AATGTTGTCAATGAAGCGTAATGGACACTATGTCAATATAAAACT
Bos taurus clone CH240-20M17, WORKING DRAFT SEQUENCE, 29 unordered pieces.
AC182477.3:119259-119273
TGTTTATATGTAACAAATTGGAAAACTTCA119259AATGTTGTCAATGAAATCTCTTAGAAACCAATGCAAATATACTTG
Bos taurus clone CH240-282D4, WORKING DRAFT SEQUENCE, 10 unordered pieces.
AC182931.2:6693-6707
AAATGTCTAGTTAAATGATGCTTTCGTTTT6693AATGTTGTCAATGAAACATCTTAAATCTCATTGCTCTGCTCACAG
Bos taurus clone CH240-397N9, WORKING DRAFT SEQUENCE, 29 unordered pieces.
AC184887.2:271539-271553
CTTTTCATGAGAATTCTCTACCTTTTAAAA271539AATGTTGTCAATGAATTTAAAGCAGTGAGTCAGGGGGAGTCACTG
Zea mays cultivar B73 chromosome 2 clone CH201-153E14, *** SEQUENCING IN PROGRESS ***, 12 unordered pieces.
AC185322.4:57373-57387
AGAGAGAAGGCTTCCATTCAAGAGTTGATG57373AATGTTGTCAATGAAATGATGTGGAACACAGAATTTGGTATTAGG
Bos taurus clone RP42-156H10, WORKING DRAFT SEQUENCE, 3 unordered pieces.
AC185803.1:26730-26744
CTCTGACCCACCGTGGCATTCTCACTTCCC26730AATGTTGTCAATGAACTTCAAACTAAGCTCTGAAGGTCAACTGGC
Sorex araneus clone SA_Ba-421P7, WORKING DRAFT SEQUENCE, 3 ordered pieces.
AC192699.2:26618-26632
AACATCCTTCTTTTCACCTGGGGTGACATT26618AATGTTGTCAATGAAATCAAATGTAGTTTCAACCTATCATGCTTT
Zea mays chromosome 1 clone CH201-233I7; ZMMBBc0233I07, *** SEQUENCING IN PROGRESS ***, 10 unordered pieces.
AC194594.2:4911-4925
ATTTTCTCCATCATTTTTGGAATAGATCAG4911AATGTTGTCAATGAATACCACAACAAACTTATCAAGATATTCCAT
Zea mays cultivar B73 chromosome 7 clone CH201-261O24, *** SEQUENCING IN PROGRESS ***, 20 unordered pieces.
AC199511.5:179814-179828
ATGTTCTTCGTCATCTTTGGAATAGATCAG179814AATGTTGTCAATGAATACCACAACAAACTTATCAAGATATTCCAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ddbj125htg/AATGTTGTCAATGAA
lang : en | db : ddbj125htg | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.009 | 0.009 | search_start;
0.084 | 0.075 | search_plus_done; http://172.18.8.78:27718/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.120 | 0.036 | search_minus_done; http://172.18.8.78:27718/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=0
0.120 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).