GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-12-08 12:35:59, GGGenome : DDBJ release 125.0, PLN division (Dec, 2021)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Pedinophyceae sp. YPF-701 chloroplast AtpB gene for ATP synthase CF1 beta subunit, partial cds.
AB561013.1:347-361
CGTGACGTAAACAAGCAAGACGTTCTTTTA347TTCATTGACAACATTTTCCGTTTCGTACAAGCGGGTTCAGAAGTA
Oryza sativa chromosome 10 clone OSJNBa0087H07, complete sequence.
AC074283.3:87092-87106
ACAAATATATTCACAATATTGATTCACAGG87092TTCATTGACAACATTGAGTCACATACTCATTCACAATATTGATTC
Oryza sativa chromosome 3 BAC OSJNBa0044H10 genomic sequence, complete sequence.
AC084405.6:75548-75562
TGATCCCAATAGTTGTTTATTTTTGGACTC75548TTCATTGACAACATTGCCACTTTGATGACTGTTCTGACATGAATG
Medicago truncatula clone mth2-21k24, complete sequence.
AC121235.20:105578-105592
CTTTAACTCCCTTCAAAATATGAATCAAAC105578TTCATTGACAACATTTATTGTAGCATGTCGAAAATACATGTTTTT
Medicago truncatula clone mth2-36d22, complete sequence.
AC124217.21:23174-23188
ATTAACTTCTTTTCAAAGTCTAAGTCAAAA23174TTCATTGACAACATTTATTATAGCCTATCAAAAATACAGGCTAAC
Oryza sativa Japonica Group chromosome 10 clone Pseudo10p0.0-10p4.4, complete sequence.
AC145127.1:2261438-2261452
ACAAATATATTCACAATATTGATTCACAGG2261438TTCATTGACAACATTGAGTCACATACTCATTCACAATATTGATTC
Cicer arietinum strain FLIP84-92C clone gl1-15o9, complete sequence.
AC145456.1:41857-41871
AGGAATTATGCATTCTGCCATAAACTGCTA41857TTCATTGACAACATTTCCCACATCACTTCCTTAAATTTCCCTACA
Medicago truncatula clone mth2-15m24, complete sequence.
AC148292.9:91765-91779
ATTAACTTCTTTTCAAAGTCTAAGTCAAAA91765TTCATTGACAACATTTATTATAGCCTATCAAAAATACAGGCTAAC
Glycine max strain Williams 82 clone GM_WBb0027P13, complete sequence.
AC235233.1:154767-154781
TTGGATCAATTTTAGCCATTTATACACGAT154767TTCATTGACAACATTGTGGATGTCAAAGCTGATGGTAACTATGGA
Solanum lycopersicum chromosome 3 clone C03HBa0203H10, complete sequence.
AC238462.1:11772-11786
CATTAACCACTAGGCCACACCATTGAGCAC11772TTCATTGACAACATTTACTGATTAAAATTTAATTCAATAAAACAA
Brassica rapa subsp. pekinensis cultivar Inbred line 'Chiifu' clone KBrB022F09, complete sequence.
AC240998.1:80363-80377
CGTGATGCCGAAGGCCAAGATGTGTTGCTT80363TTCATTGACAACATTTTCCGTTTCACTCAGGTGAGCCTTTTTGTT
Solanum lycopersicum strain Heinz 1706 chromosome 10 clone hba-7g17 map 10, complete sequence.
AC244076.4:47296-47310
AGAAGTTACCTAAATTCATTTGTCATTGTC47296TTCATTGACAACATTTTGGTATATTCAAAAAATGTGGGTGAACAC
Passiflora edulis clone Pe51C2, complete sequence.
AC278225.1:9003-9017
AAGTATTTCAGAAGTAATAACTAAGATGAC9003TTCATTGACAACATTTTTATCTCAGGGGTTTACATGCCATTGGGG
Ashbya gossypii ATCC 10895 chromosome II, complete sequence.
AE016815.5:720399-720413
AGAGACGAGGAGGGTCAGGATGTGTTGCTG720399TTCATTGACAACATTTTCAGATTCACCCAAGCCGGTTCCGAAGTG
Salvinia molesta ATP synthase beta chain (atpB) gene, partial cds; chloroplast gene for chloroplast product.
AF313552.1:512-526
CGAGATGTCAACAAGCAAGACGTACTCCTA512TTCATTGACAACATTTTTCGTTTCGTCCAAGCGGGATCAGAAGTC
Arabidopsis thaliana mRNA for mitochondrial F1 ATP synthase beta subunit (p_beta gene).
AJ271468.1:1572-1586
CGTGATGCTGAAGGCCAAGACGTTTTGCTT1572TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
Oryza sativa Japonica Group cDNA clone:001-037-A03, full insert sequence.
AK061681.1:1029-1043
CGTGATGCCGAAGGACAAGATGTGCTTTTG1029TTCATTGACAACATTTTCCGTTTCACTCAGGCGAACTCTGAGGTG
Oryza sativa Japonica Group cDNA clone:002-127-D01, full insert sequence.
AK107392.1:1246-1260
GCTCTCTGATCAACACTCTTTTTCGGAACA1246TTCATTGACAACATTCGTCGAGCTGGACTCGACCATGGATTATGG
Oryza sativa Japonica Group cDNA clone:002-153-G05, full insert sequence.
AK108995.1:907-921
CGTGACCAGGAGGGACAGGATGTCTTGCTC907TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Arabidopsis thaliana At5g08670 mRNA for putative H+-transporting ATP synthase beta chain (mitochondrial), complete cds, clone: RAFL19-76-L24.
AK118538.1:1017-1031
CGTGATGCTGAAGGCCAAGACGTTTTGCTT1017TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
Arabidopsis thaliana At5g08690 mRNA for putative H+-transporting ATP synthase beta chain (mitochondrial), complete cds, clone: RAFL19-82-J07.
AK118582.1:1017-1031
CGTGATGCTGAAGGCCAAGATGTCTTGCTT1017TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
Hordeum vulgare subsp. vulgare mRNA for predicted protein, complete cds, clone: NIASHv1027K09.
AK355900.1:1834-1848
TTTGGCTCAGGTTTACCCTCTTGCCTATTT1834TTCATTGACAACATTTGTCAGTATATCGCTTCTAATTTTACTCAG
Hordeum vulgare subsp. vulgare mRNA for predicted protein, complete cds, clone: NIASHv2010F24.
AK362825.1:829-843
AGAGATGAGGAGGGTAAGGACGTGCTGCTT829TTCATTGACAACATTTTCCGCTTCACCCAAGCTTGCTCAGAGGTG
Hordeum vulgare subsp. vulgare mRNA for predicted protein, complete cds, clone: NIASHv3077J11.
AK374834.1:952-966
CGTGACGAGGAGGGTCAGGATGTGCTTCTC952TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Arabidopsis thaliana DNA chromosome 5, BAC clone T2K12 (ESSA project).
AL590346.1:28840-28854
CGTGATGCTGAAGGCCAAGATGTCTTGCTT28840TTCATTGACAACATTTTCCGTTTCACTCAGGTAAGCCTTGTTATG
Azolla pinnata chloroplast partial atpB gene for putative beta subunit of chloroplast ATP synthase, specimen voucher Schneider s.n. (GOET).
AM176622.1:512-526
CGAGATGTCAACAAGCAAGATGTACTTCCA512TTCATTGACAACATTTTTCGGTTCGTCCAAGCGGGATCAGAAGTC
Salvinia oblongifolia chloroplast partial atpB gene for putative beta subunit of chloroplast ATP synthase, specimen voucher Unknown.
AM176624.1:477-491
CGAGATGTCAACAAGCAAGACGTACTTCTA477TTCATTGACAACATTTTTCGTTTCGTCCAAGCGGGATCAGAAGTC
Vitis vinifera, whole genome shotgun sequence, contig VV78X040248.2, clone ENTAV 115.
AM460727.1:42408-42422
AACAACCAAACAGGTCCTAAACCTCTCACT42408TTCATTGACAACATTATATCCTCAGGTCTTATTCTCTACCATTGT
Vitis vinifera contig VV78X024264.3, whole genome shotgun sequence.
AM482307.1:596-610
TCTTTAAATGGAACAAAATACTATATTCAT596TTCATTGACAACATTATCTTAATGTATTCGGATGATAGGGAAGAC
Oryza sativa Japonica Group genomic DNA, chromosome 7, PAC clone:P0453E05.
AP004275.3:32147-32161
AGATCTATCTAATTTAGGTGTAGTGCTCTC32147TTCATTGACAACATTTTTCACTTCCTGCGTTAGGTTTCCATTATC
Oryza sativa Japonica Group genomic DNA, chromosome 7, PAC clone:P0492E07.
AP004305.3:26834-26848
CGTGTGCCTCCTGGATGCACCAATCGGCTG26834TTCATTGACAACATTTTGTTGAAGGACCTTGGCAACATCTTTTTG
Oryza sativa Japonica Group genomic DNA, chromosome 9, PAC clone:P0556H01.
AP005424.3:30622-30636
CTTTCAAATGATGGTCAAACTAATTATAAA30622TTCATTGACAACATTAACTAAACGAGTGAAGAGTGAAGAGAAGAT
Oryza sativa Japonica Group genomic DNA, chromosome 9, BAC clone:OJ1328_D07.
AP005833.2:126234-126248
CTTTCAAATGATGGTCAAACTAATTATAAA126234TTCATTGACAACATTAACTAAACGAGTGAAGAGTGAAGAGAAGAT
Aspergillus oryzae RIB40 DNA, SC010.
AP007175.1:1292143-1292157
CGTGACGAGGAAGGTCAGGATGTGCTGCTC1292143TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Oryza sativa Japonica Group DNA, chromosome 3, cultivar: Nipponbare, complete sequence.
AP014959.1:9682664-9682678
TGATCCCAATAGTTGTTTATTTTTGGACTC9682664TTCATTGACAACATTGCCACTTTGATGACTGTTCTGACATGAATG
Oryza sativa Japonica Group DNA, chromosome 7, cultivar: Nipponbare, complete sequence.
AP014963.1:12705943-12705957
CGTGTGCCTCCTGGATGCACCAATCGGCTG12705943TTCATTGACAACATTTTGTTGAAGGACCTTGGCAACATCTTTTTG
Oryza sativa Japonica Group DNA, chromosome 7, cultivar: Nipponbare, complete sequence.
AP014963.1:24274176-24274190
AGATCTATCTAATTTAGGTGTAGTGCTCTC24274176TTCATTGACAACATTTTTCACTTCCTGCGTTAGGTTTCCATTATC
Oryza sativa Japonica Group DNA, chromosome 9, cultivar: Nipponbare, complete sequence.
AP014965.1:16180672-16180686
CTTTCAAATGATGGTCAAACTAATTATAAA16180672TTCATTGACAACATTAACTAAACGAGTGAAGAGTGAAGAGAAGAT
Oryza sativa Japonica Group DNA, chromosome 10, cultivar: Nipponbare, complete sequence.
AP014966.1:2282429-2282443
ACAAATATATTCACAATATTGATTCACAGG2282429TTCATTGACAACATTGAGTCACATACTCATTCACAATATTGATTC
Vigna angularis var. angularis DNA, chromosome 2, almost complete sequence, cultivar: Shumari.
AP015035.1:2763351-2763365
GTGTATCAATTAAATCTATTCCGTCAATTT2763351TTCATTGACAACATTAATTGTGTGGTTATGTAGCAAAAGAGTGTA
Vigna angularis var. angularis DNA, chromosome 4, almost complete sequence, cultivar: Shumari.
AP015037.1:17743347-17743361
TCCTCAAGTTGGAAGTTCTTACGCGTATTT17743347TTCATTGACAACATTATTTACTAGAGGTCCTTCACCATTTAGTGT
Vigna angularis var. angularis DNA, chromosome 8, almost complete sequence, cultivar: Shumari.
AP015041.1:3253525-3253539
TATATTTAGGTTTGCAGAATTATAGATGAA3253525TTCATTGACAACATTTGCAATGTTGGTGACCACTTGCTTACTTTG
Prunus dulcis DNA, pseudomolecule Pd03.
AP019299.1:15714560-15714574
GGGTTTTGATGCCAAGCCACGTGTGAGGCT15714560TTCATTGACAACATTTTCTTGCATTAAAAAATTCTAAGGGGACAA
Prunus dulcis DNA, pseudomolecule Pd04.
AP019300.1:4537392-4537406
AATATAGTAGATGAAGGTTGAATCTGGATT4537392TTCATTGACAACATTCAGAAAGGGGTGTATTTGAATAAAAAAGTT
Prunus dulcis DNA, pseudomolecule Pd04.
AP019300.1:6238962-6238976
ATAAGTTTTCTCTGTTCGGTTTAATTATTT6238962TTCATTGACAACATTGGATCATGTTAGAATTTCAAGATAAACAGA
Prunus dulcis DNA, pseudomolecule Pd07.
AP019303.1:11626678-11626692
AACAAACAATTTTAGTAAGTGAAATCTTAA11626678TTCATTGACAACATTCTACAGGAATTTATTAATCTATCTTTCCAG
Marchantia polymorpha subsp. ruderalis Tak-1 DNA, chromosome: 1.
AP019866.1:22155075-22155089
CAAAAAACTATGAATAATTCCATTGATTAT22155075TTCATTGACAACATTGGAGTGATTAGATCACTCAATATAGAATTC
Prunus dulcis DNA, unplaced-scaffold_283.
AP020620.1:8084-8098
GAAGTTTCCCTCTGTTCGGTTTAATTATTT8084TTCATTGACAACATTGGATCATGGTTCCAATTTCAAGAGAAACAA
Lotus japonicus B-129 DNA, chromosome 1, complete sequence.
AP022629.1:45918300-45918314
TTTATAATAGAAGTTTCCTTGAAAAATTTA45918300TTCATTGACAACATTCTTAATTACAGGAGAAACTTGGCTCTATAT
Lotus japonicus B-129 DNA, chromosome 2, complete sequence.
AP022630.1:11714130-11714144
AGACTATTCTTGGACAAGTTCGTGGTGGTG11714130TTCATTGACAACATTCTGATTTACTCGAAGAGAAAAGAGGAACAC
Lipomyces suomiensis strain CBS 7251 isolate ATP2_C38 ATP synthase (ATP2) gene, partial cds.
KF042704.1:466-480
CGTGACGAGGAGGGACAGGATGTGTTGCTC466TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Pichia pseudocactophila strain CBS 6929 isolate ATP2_C32 ATP synthase (ATP2) gene, partial cds.
KF042712.1:556-570
CGTGACGAAGAAGGTCAGGATGTGTTGCTC556TTCATTGACAACATTTTCCGATTCACCCAAGCTGGTTCTGAGGTA
Cyberlindnera mississippiensis strain CBS 7023 isolate ATP2_C35 ATP synthase (ATP2) gene, partial cds.
KF042721.1:556-570
AGAGATGAGGAGGGTCAGGATGTGTTGTTG556TTCATTGACAACATTTTCAGATTCACCCAGGCCGGTTCTGAAGTG
Oryza sativa Japonica Group ATP synthase beta chain mRNA, complete cds.
KF214533.1:1017-1031
CGTGATGCCGAAGGACAAGATGTGCTTTTG1017TTCATTGACAACATTTTCCGTTTCACTCAGGCGAACTCTGAGGTG
Vittaria lineata isolate MJ1066_F220_PANAMA ATP synthase beta subunit (atpB) gene, partial cds; chloroplast.
KJ716384.1:487-501
AGAGATATCAACAAGAGAGATGTACTCTTA487TTCATTGACAACATTTTCCGATTTGTACAAGCAGGATCTGAGGTT
Anetium citrifolium isolate MJ838_F141_PANAMA ATP synthase beta subunit (atpB) gene, partial cds; chloroplast.
KJ716386.1:493-507
AGAGATATCAACAAGCGAGATGTACTTTTA493TTCATTGACAACATTTTTCGATTTGTACAGGCAGGATCTGAGGTT
Zea mays isolate TCONS_00028443 drought responsive lncRNA, complete sequence.
KJ731974.1:234-248
CTTCCTTTTAGAAACAGGTCTACGCGAACT234TTCATTGACAACATTTGCATATATATATATATATATATATTCATT
Nephroselmis astigmatica culture-collection NIES:252 chloroplast, complete genome.
KJ746600.1:35860-35874
CGCGATGAAAATGGTCAGGATGTATTGCTC35860TTCATTGACAACATTTTCCGCTTTACTCAAGCTGGTTCCGAAGTT
Pteris dentata voucher Tamon s.n. ATP synthase beta chain (atpB) gene, partial cds; chloroplast.
KM007719.1:494-508
CGAGATATTAACAAACAAGATGTACTCCTA494TTCATTGACAACATTTTTCGTTTTGTCCAAGCGGGGTCGGAGGTC
Hirsutella thompsonii strain MTCC6686 chitinase (Chi-5) mRNA, complete cds.
KM220993.1:367-381
ATCATGAAAGACGAGGCTACGCGCAGCAAG367TTCATTGACAACATTGTCGACTTCATCAAGACCAATGATTTGGAC
Hirsutella thompsonii strain MTCC3556 chitinase (Chi-5) mRNA, complete cds.
KM221007.1:325-339
ATCATGAAAGACGAGGCTACGCGCAGCAAG325TTCATTGACAACATTGTCGACTTCATCAGGACCAATGATTTGGAT
Xylochloris irregularis culture-collection CAUP:H7801 chloroplast, complete genome.
KM462872.1:121429-121443
CGAGACATAAACAAACAAGACGTTCTCCTG121429TTCATTGACAACATTTTTCGTTTTGTCCAAGCGGGCTCTGAAGTT
Adiantum menglianense voucher Yan12409 ATP synthase beta chain (atpB) gene, partial cds; chloroplast.
KP637197.1:583-597
CGAGATATCAACAAGCGAGATGTACTCCTA583TTCATTGACAACATTTTTCGCTTTGTCCAGGCGGGGTCGGAAGTT
Adiantum menglianense voucher Yan12415 ATP synthase beta chain (atpB) gene, partial cds; chloroplast.
KP637198.1:583-597
CGAGATATCAACAAGCGAGATGTACTCCTA583TTCATTGACAACATTTTTCGCTTTGTCCAGGCGGGGTCGGAAGTT
Adiantum philippense voucher Yan12086 ATP synthase beta chain (atpB) gene, partial cds; chloroplast.
KP637199.1:583-597
CGAGATATCAACAAGCGAGATGTACTCCTA583TTCATTGACAACATTTTTCGCTTTGTCCAGGCGGGGTCGGAAGTT
Adiantum philippense voucher Yan12405 ATP synthase beta chain (atpB) gene, partial cds; chloroplast.
KP637200.1:583-597
CGAGATATCAACAAGCGAGATGTACTCCTA583TTCATTGACAACATTTTTCGCTTTGTCCAGGCGGGGTCGGAAGTT
Orobanche crenata clone Ocre-c1839921 genomic sequence.
KT367073.1:1591-1605
CGTGACGCAGAAGGGCAGGATGTGCTTCTC1591TTCATTGACAACATTTTCCGTTTTACACAAGTAAGCTGGTGATGT
Azolla japonica strain NTUAJ1 ATP synthase beta chain (atpB) gene, partial cds; chloroplast.
KT862377.1:463-477
CGAGATGTTAACAAGCAAGATGTACTTCCA463TTCATTGACAACATTTTTCGTTTCGTCCAAGCGGGATCAGAAGTC
Azolla pinnata strain NTUAP1 ATP synthase beta chain (atpB) gene, partial cds; chloroplast.
KT862378.1:463-477
CGAGATGTCAACAAGCAAGATGTACTTCCA463TTCATTGACAACATTTTTCGGTTCGTCCAAGCGGGATCAGAAGTC
Adiantum capillus-junonis isolate HB1-1 ATP synthase beta chain (atpB) gene, partial cds; chloroplast.
KY450793.1:572-586
AGAGATATCAACAAGCGAGATGTACTCCTA572TTCATTGACAACATTTTTCGCTTTGTCCAGGCAGGGTCGGAAGTT
Adiantum alomae voucher LR_44 (HAC) ATP synthase beta chain gene, partial cds; chloroplast.
KY934297.1:586-600
CGAGATATCAACAAGCGAGATGTACTCTTA586TTCATTGACAACATTTTTCGCTTTGTCCAGGCGGGGTCGGAGGTC
Adiantum capillus-veneris voucher LR_187 (HAC) ATP synthase beta chain gene, partial cds; chloroplast.
KY934298.1:575-589
CGAGATATCAATAAGCGAGATGTACTTCTG575TTCATTGACAACATTTTTCGCTTCGTTCAGGCGGGGTCGGAGGTC
Adiantum capillus-veneris voucher LR_244 (HAC) ATP synthase beta chain gene, partial cds; chloroplast.
KY934299.1:586-600
CGAGATATCAATAAGCGAGATGTACTTCTG586TTCATTGACAACATTTTTCGCTTCGTTCAGGCGGGGTCGGAGGTC
Adiantum deltoideum voucher LR_101 (HAC) ATP synthase beta chain gene, partial cds; chloroplast.
KY934311.1:586-600
CGAGATATCAACAAGCGAGATGTACTCTTA586TTCATTGACAACATTTTTCGCTTTGTCCAGGCGGGGTCGGAGGTC
Adiantum deltoideum voucher LR_183 (HAC) ATP synthase beta chain gene, partial cds; chloroplast.
KY934312.1:586-600
CGAGATATCAACAAGCGAGATGTACTCTTA586TTCATTGACAACATTTTTCGCTTTGTCCAGGCGGGGTCGGAGGTC
Adiantum fragile voucher LR_160 (HAC) ATP synthase beta chain gene, partial cds; chloroplast.
KY934313.1:586-600
CGAGATATAAACAAGCGAGATGTACTCTTA586TTCATTGACAACATTTTTCGCTTTGTCCAGGCGGGGTCGGAGGTC
Adiantum fragile voucher LR_60 (HAC) ATP synthase beta chain gene, partial cds; chloroplast.
KY934314.1:586-600
CGAGATATAAACAAGCGAGATGTACTCTTA586TTCATTGACAACATTTTTCGCTTTGTCCAGGCGGGGTCGGAGGTC
Adiantum melanoleucum voucher LR_200 (HAC) ATP synthase beta chain gene, partial cds; chloroplast.
KY934317.1:586-600
CGGGATATCAACAAGCGAGATGTACTCCTA586TTCATTGACAACATTTTTCGTTTCGTCCAGGCGGGTTCGGAGGTC
Adiantum melanoleucum voucher LR_207 (HAC) ATP synthase beta chain gene, partial cds; chloroplast.
KY934318.1:586-600
CGGGATATCAACAAGCGAGATGTACTCCTA586TTCATTGACAACATTTTTCGTTTCGTCCAGGCGGGTTCGGAGGTC
Adiantum sericeum voucher LR_162 (HAC) ATP synthase beta chain gene, partial cds; chloroplast.
KY934327.1:586-600
CGAGATATCAACAAGCGAGATGTACTCTTA586TTCATTGACAACATTTTTCGCTTTGTCCAGGCGGGGTCGGAGGTC
Adiantum tenerum voucher LR_194 (HAC) ATP synthase beta chain gene, partial cds; chloroplast.
KY934328.1:586-600
CGAGATATAAACAAGCGAGATGTACTCCTA586TTCATTGACAACATTTTTCGCTTTGTCCAGGCGGGGTCGGAGGTC
Penicillium citreosulfuratum IMI 92228 g2666 gene for hypothetical protein, complete cds.
LC517110.1:1368-1382
CGTGACGACGAGGGTCAGGATGTGCTGCTC1368TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Lichtheimia ramosa strain JMRC FSU:6197 genome assembly, scaffold: SCAF12.
LK023316.1:873536-873550
CGTGATGAAGAGGGTCAAGATGTGTTGCTT873536TTCATTGACAACATTTTCCGTTTCACTCAAGCCGGTTCTGAAGTG
Cucumis melo genomic scaffold, anchoredscaffold00034.
LN681792.1:889015-889029
TTTTTTTTCCCTTTAATGAATAATTAAACT889015TTCATTGACAACATTTGGGAGTAAAAACCTCTTTCTATTCAATAA
Cucumis melo genomic scaffold, anchoredscaffold00050.
LN681914.1:1574831-1574845
AAGGACTTCCTAGACTCGTTCGTCATAGTT1574831TTCATTGACAACATTTTGATTTACTCCAAAATTGAGGCTGAGCAT
Cucumis melo genomic scaffold, unassembled_sequence35642.
LN687912.1:63-77
AAGGATTTTTTAGACACGTTCGTCATAGTT63TTCATTGACAACATTTTGATTTACTTTTGTTTGCTTTGTTTGCAA
Cucumis melo genomic chromosome, chr_1.
LN713255.1:889015-889029
TTTTTTTTCCCTTTAATGAATAATTAAACT889015TTCATTGACAACATTTGGGAGTAAAAACCTCTTTCTATTCAATAA
Cucumis melo genomic chromosome, chr_3.
LN713257.1:11246285-11246299
AATTCTTCCGCTGTAAAGAGTTTTCATCCC11246285TTCATTGACAACATTATGTTTGGTGGAATGTCTCAGGAGATGATT
Podospora comata strain T genome assembly, chromosome: 6.
LR026969.1:988742-988756
ACGCTAACCTGATGCTTCTCAGTGTTGCTC988742TTCATTGACAACATTTTCCGCTTCACCCAGGCCGGTTCCGAGGTG
Brassica rapa genome, scaffold: A02.
LR031573.1:1332366-1332380
CGTGATGCTGAGGGCCAAGATGTGTTGCTT1332366TTCATTGACAACATTTTCCGATTCACTCAGGTGAGCTATGTTGTT
Brassica rapa genome, scaffold: A10.
LR031577.1:15342792-15342806
CGTGATGCTGAAGGCCAAGATGTGTTGCTT15342792TTCATTGACAACATTTTCCGTTTCACTCAGGTGAGCTACTGTGTT
Brassica oleracea HDEM genome, scaffold: C2.
LR031874.1:2196473-2196487
CGTGATGCCGAGGGCCAAGATGTGTTGCTT2196473TTCATTGACAACATTTTCCGTTTCACTCAGGTGAGCTATGTTGTT
Brassica oleracea HDEM genome, scaffold: C9.
LR031875.1:59900178-59900192
CGTGATGCCGAAGGCCAAGATGTGTTGCTT59900178TTCATTGACAACATTTTCCGTTTCACTCAGGTGAGCTCTGTTCTT
Arabidopsis thaliana genome assembly, chromosome: 5.
LR215056.1:2837116-2837130
CGTGATGCTGAAGGCCAAGATGTCTTGCTT2837116TTCATTGACAACATTTTCCGTTTCACTCAGGTAAGCCTTGTTATG
Arabidopsis thaliana genome assembly, chromosome: 5.
LR699754.1:2839927-2839941
CGTGATGCTGAAGGCCAAGATGTCTTGCTT2839927TTCATTGACAACATTTTCCGTTTCACTCAGGTAAGCCTTGTTATG
Arabidopsis thaliana genome assembly, chromosome: 5.
LR699759.1:2818372-2818386
CGTGATGCTGAAGGCCAAGATGTCTTGCTT2818372TTCATTGACAACATTTTCCGTTTCACTCAGGTAAGCCTTGTTATG
Arabidopsis thaliana genome assembly, chromosome: 5.
LR699764.1:2830385-2830399
CGTGATGCTGAAGGCCAAGATGTCTTGCTT2830385TTCATTGACAACATTTTCCGTTTCACCCAGGTGAGTCTTATTTTG
Arabidopsis thaliana genome assembly, chromosome: 5.
LR699764.1:2836351-2836365
CGTGATGCTGAAGGCCAAGATGTCTTGCTT2836351TTCATTGACAACATTTTCCGTTTCACTCAGGTAAGCCTTGTTATG
Arabidopsis thaliana genome assembly, chromosome: 1.
LR699765.1:15706357-15706371
AATTGTGTATCTATATAAAATGTTATGTTA15706357TTCATTGACAACATTATTCACATCTAAATTATTTTGTGTCTGTTT
Arabidopsis thaliana genome assembly, chromosome: 5.
LR699769.1:2847665-2847679
CGTGATGCTGAAGGCCAAGATGTCTTGCTT2847665TTCATTGACAACATTTTCCGTTTCACTCAGGTAAGCCTTGTTATG
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828110.1:15380624-15380638
CCCATAGTTTTTTAATAACAACATATTTTT15380624TTCATTGACAACATTTTACACAGAGTATTGTGAAATGTCTCACAC
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828110.1:432032198-432032212
CGCTATGTAATGAGCTCCAACAATATTTTA432032198TTCATTGACAACATTTAGAGCCCATTTGGGACAGCTCTGCTCCTT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 4H.
LR828111.1:468899114-468899128
TCAGACCATGCCTGCCACACATTCAAAATG468899114TTCATTGACAACATTGGAGGGGGTGGCACACTTAGCGGTGCATCA
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR828115.1:320272311-320272325
GCATCCAAATAGGCAGAAACTTAGGAGAAT320272311TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTCAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828117.1:17019486-17019500
CCCATAGTTTTTTAACAACAACATATTTTT17019486TTCATTGACAACATTTTACACAGAGTATTGTGAAATGTCTCACAC
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828117.1:440362652-440362666
CGCTATGTAATGAGCTCCAACAATATTTTA440362652TTCATTGACAACATTTAGAGCCCATTTGGGACAGCTCTGCTCCTT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 4H.
LR828118.1:474844800-474844814
TCAGACCATGCCTGCCACACATTCAAAATG474844800TTCATTGACAACATTGGAGGGGGTGGCACACTTAGCGGTGCATCA
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR828132.1:337164338-337164352
GCATCCAAATAGGCAGAAACTTAGGAGAAT337164338TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTTAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828134.1:16512423-16512437
CCCATAGTTTTTTAATAACAACATATTTTT16512423TTCATTGACAACATTTTACACAGAGTATTGTGAAATGTCTCACAC
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828134.1:469587502-469587516
CGCTATGTAATGAGCTCCAACAATATTTTA469587502TTCATTGACAACATTTAGAGCCCATTTGGGACAGCTCTGCTCCTT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 4H.
LR828135.1:516083120-516083134
TCAGACCATGCCTGCCACACATTCAAAATG516083120TTCATTGACAACATTGGAGGGGGTGGCACACTTAGCGGTGCATCA
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR828139.1:344355819-344355833
GCATCCAAATAGGCAGAAACTTAGGAGAAT344355819TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTTAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828141.1:17545402-17545416
CCCATAGTTTTTTAACAACAACATATTTTT17545402TTCATTGACAACATTTTACACAGAGTATTGTGAAATGTCTCACAC
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 4H.
LR828142.1:520329488-520329502
TCAGACCATGCCTGCCACACATTCAAAATG520329488TTCATTGACAACATTGGAGGGGGTGGCACACTTAGCGGTGCATCA
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR828146.2:322589417-322589431
GCATCCAAATAGGCAGAAACTTAGGAGAAT322589417TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTTAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR828153.1:306365569-306365583
GCATCCAAATAGGCAGAAACTTAGGAGAAT306365569TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTCAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828155.1:14032959-14032973
CCCATAGTTTTTTAACAACAACATATTTTT14032959TTCATTGACAACATTTTACACAGAGTATTGTGAAATGTCTCACAC
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828155.1:429128240-429128254
CGCTATGTAATGAGCTCCAACAATATTTTA429128240TTCATTGACAACATTTAGAGCCCATTTGGGACAGCTCTGCTCCTT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 4H.
LR828156.1:470067002-470067016
TCAGACCATGCCTGCCACACATTCAAAATG470067002TTCATTGACAACATTGGAGGGGGTGGCACACTTAGCGGTGCATCA
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR828160.1:330148618-330148632
GCATCCAAATAGGCAGAAACTTAGGAGAAT330148618TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTTAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 4H.
LR828163.1:501421740-501421754
TCAGACCATGCTTGCCACACATTCAAAATG501421740TTCATTGACAACATTGGAGGGGGTGGCACACTTAGCGGTGCATCA
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR828167.1:322410073-322410087
GCATCCAAATAGGCAGAAACTTAGGAGAAT322410073TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTTAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828169.1:16719106-16719120
CCCATAGTTTTTTAACAACAACATATTTTT16719106TTCATTGACAACATTTTACACAGAGTATTGTGAAATGTCTCACAC
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 4H.
LR828170.1:488159504-488159518
TCAGACCATGCCTGCCACACATTCAAAATG488159504TTCATTGACAACATTGGAGGGGGTGGCACACTTAGCGGTGCATCA
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR828174.1:324828195-324828209
GCATCCAAATAGGCAGAAACTTAGGAGAAT324828195TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTTAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828176.1:16960414-16960428
CCCATAGTTTTTTAACAACAACATATTTTT16960414TTCATTGACAACATTTTACACAGAGTATTGTGAAATGTCTCACAC
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 4H.
LR828177.1:490798058-490798072
TCAGACCATGCCTGCCACACATTCAAAATG490798058TTCATTGACAACATTGGAGGGGGTGGCACACTTAGCGGTGCATCA
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR828181.1:322833339-322833353
GCATCCAAATAGGCAGAAACTTAGGAGAAT322833339TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTTAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828183.1:448028472-448028486
CGCTATGTAATGAGCTCCAACAATATTTTA448028472TTCATTGACAACATTTAGAGCCCATTTGGGACAGCTCTGCTCCTT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 4H.
LR828184.1:488702280-488702294
TCAGACCATGCCTGCCACACATTCAAAATG488702280TTCATTGACAACATTGGAGGGGGTGGCACACTTAGCGGTGCATCA
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR828188.1:323150607-323150621
GCATCCAAATAGGCAGAAACTTAGGAGAAT323150607TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTTAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828190.1:16196074-16196088
CCCATAGTTTTTTAATAACAACATATTTTT16196074TTCATTGACAACATTTTACACAGAGTATTGTGAAATGTCTCACAC
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 4H.
LR828191.1:493295969-493295983
TCAGACCATGCCTGCCACACATTCAAAATG493295969TTCATTGACAACATTGGAGGGGGTGGCACACTTAGCGGTGCATCA
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR828266.1:322720672-322720686
GCATCCAAATAGGCAGAAACTTAGGAGAAT322720672TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTTAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828268.1:16696895-16696909
CCCATAGTTTTTTAACAACAACATATTTTT16696895TTCATTGACAACATTTTACACAGAGTATTGTGAAATGTCTCACAC
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828268.1:444816884-444816898
CGCTATGTAATGAGCTCCAACAATATTTTA444816884TTCATTGACAACATTTAGAGCCCATTTGGGACAGCTCTGCTCCTT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 4H.
LR828269.1:487118419-487118433
TCAGACCATGCCTGCCACACATTCAAAATG487118419TTCATTGACAACATTGGAGGGGGTGGCACACTTAGCGGTGCATCA
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR828273.1:332192915-332192929
GCATCCAAATAGGCAGAAACTTAGGAGAAT332192915TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTTAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828275.1:16941939-16941953
CCCATAGTTTTTTAATAACAACATATTTTT16941939TTCATTGACAACATTTTACACAGAGTTTGTGAAATGTCTCACACT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR828275.1:463559097-463559111
CGCTATGTAATGAGCTCCAACAATATTTTA463559097TTCATTGACAACATTTAGAGCCCATTTGGGACAGCTCTGCTCCTT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 4H.
LR828276.1:506306493-506306507
TCAGACCATGCCTGCCACACATTCAAAATG506306493TTCATTGACAACATTGGAGGGGGTGGCACACTTAGCGGTGCATCA
Triticum aestivum genome assembly, chromosome: 1A.
LR862508.1:400650294-400650308
CCATGTACAGTACTCTTCCGACAGAAGTCG400650294TTCATTGACAACATTGACCACGCCATGCCAAGAGCACCAGGGCGG
Triticum aestivum genome assembly, chromosome: 1B.
LR862509.1:234036566-234036580
AACGTAGTCCATTGGTCTGCCATGTATCAG234036566TTCATTGACAACATTCTGTACAGAAAAAGACCAAATGGTGTGAAA
Triticum aestivum genome assembly, chromosome: 1D.
LR862510.1:58624414-58624428
CCACGTACAGTACTCTTCCGATGGAAGTCG58624414TTCATTGACAACATTGACCACGCCGCGCTGAGAGCACCAGGGTGG
Triticum aestivum genome assembly, chromosome: 2B.
LR862512.1:143084195-143084209
TATGATCTATATAAATATTATCACTTAAAA143084195TTCATTGACAACATTTCTTAAGAAAAGCAAATTATCCATTCACAA
Triticum aestivum genome assembly, chromosome: 2B.
LR862512.1:304560016-304560030
CAGAGCGCACAGTTAAACCCGGTCTGGTAA304560016TTCATTGACAACATTCACAACAACCGATGGTTATGCATCTAAATG
Triticum aestivum genome assembly, chromosome: 2B.
LR862512.1:488393597-488393611
AGCCATTGTCGGTGAAGTGGCGTCGTATTC488393597TTCATTGACAACATTCGCAACAACAGTTGCAGCCGAAGATGAATA
Triticum aestivum genome assembly, chromosome: 3A.
LR862514.1:125551835-125551849
GAAATGATCACCCATTTTATTATACAACTT125551835TTCATTGACAACATTCATAACTAAAAAGCGTCTCTTCACTGATGT
Triticum aestivum genome assembly, chromosome: 3A.
LR862514.1:384154181-384154195
CCGTATATAGTCGTCTTTCGATGGCTGTCA384154181TTCATTGACAACATTGACAACGCCGCACCGAGAGCACCAAGGCGG
Triticum aestivum genome assembly, chromosome: 3A.
LR862514.1:665498565-665498579
CCGTGTACAGTCGTCTTCCGATGGATGTCG665498565TTCATTGACAACATTGACCACGCCGTGCCGATAGCACTAAGGCGG
Triticum aestivum genome assembly, chromosome: 3B.
LR862515.1:135554796-135554810
AAAGTAGCCCGCTGGTCTGCTCTGTACCAG135554796TTCATTGACAACATTCTGTACAGAAAAAGGCCGAATGGAGTGAAA
Triticum aestivum genome assembly, chromosome: 3B.
LR862515.1:499500883-499500897
GTTTGGCAACTTAAGAGAAGGGATTTTCAA499500883TTCATTGACAACATTGCTAAGAGGCTTAAACAGAAGGAACATCAC
Triticum aestivum genome assembly, chromosome: 4B.
LR862518.1:160069156-160069170
AAAGTAGCCCGACGGTCTGCCCTGTACCAG160069156TTCATTGACAACATTCTATACAGAAAAAGGCCAAACGGAGTGAGA
Triticum aestivum genome assembly, chromosome: 4B.
LR862518.1:200213124-200213138
AAAGTATCTCGTCGGTCCGCCATGTACCAG200213124TTCATTGACAACATTCTGTACAGAAAAAGAACGAATGGTGTGAAA
Triticum aestivum genome assembly, chromosome: 4B.
LR862518.1:249153733-249153747
CCGCGTACAATAATCTTTCGATGGCTGTCG249153733TTCATTGACAACATTGACCACACCACTCCGACAACACCCAGGTGG
Triticum aestivum genome assembly, chromosome: 4B.
LR862518.1:257648275-257648289
GAAATGATCACCCATTTTATTATACTACTT257648275TTCATTGACAACATTCATAACTAAAAAGCGTCTCTTCACTGATGT
Triticum aestivum genome assembly, chromosome: 4B.
LR862518.1:314297027-314297041
AGAGTAGCCCGCCAGTCTACTCTATACCAG314297027TTCATTGACAACATTCTGTACAGAAAAAGACCAAATGGAGTGAAA
Triticum aestivum genome assembly, chromosome: 4B.
LR862518.1:432194374-432194388
CCACGTACAGTCCACGTCCGATGGATGTCA432194374TTCATTGACAACATTGACCAGGCTGCACCGAGAGCACCATGGCGG
Triticum aestivum genome assembly, chromosome: 5A.
LR862520.1:668109699-668109713
TCTCCAGATTGTACAGCTGCAGCAAATTGA668109699TTCATTGACAACATTCTAATTAGTTTCATGCAACACCGTTTGCAG
Triticum aestivum genome assembly, chromosome: 5B.
LR862521.1:540920171-540920185
AAAGTAGCCCGCTGGTCTGCTTTGTATCAA540920171TTCATTGACAACATTTTGTACAGAAGGAGACCGAATGGGGTGAAA
Triticum aestivum genome assembly, chromosome: 6A.
LR862523.1:102472292-102472306
AACCCCTTTACTTTGAAGCTCACATAATCT102472292TTCATTGACAACATTTAGTATGCAAAATAGGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR862524.1:175777773-175777787
AACCCCTTTAGTTTGAACTTAACACAATCT175777773TTCATTGACAACATTCAGTATGTAAAATAAGTATAATCCGAATGT
Triticum aestivum genome assembly, chromosome: 6B.
LR862524.1:175821633-175821647
GAACCCTTTACTTTGAAGCTCACATAATCT175821633TTCATTGACAACATTTAGTATGCAAAATAAGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR862524.1:662828745-662828759
CCCTTCTCTGTCACCACAGTTCTACAAGAA662828745TTCATTGACAACATTTTCAAATTGCATGGCATGCCAGTGTCTATG
Triticum aestivum genome assembly, chromosome: 7B.
LR862527.1:196839660-196839674
CCGTGTATAGTCGTCTTCCGATGGCTGTCG196839660TTCATTGACAACATTGAACATGCTGCACCGAGAGCACCAAGGCGG
Triticum aestivum genome assembly, chromosome: 7B.
LR862527.1:620558839-620558853
TGATTGTTTTCAGGTTTATGTATGTATTGT620558839TTCATTGACAACATTCCTCAAATATCAGGTAGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR862527.1:620599780-620599794
TGATTGTTTTCAGGTTTATGTATGTATTGT620599780TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR862527.1:620631951-620631965
TGATTGTTTTCAGGTTTATGTATGTATTGT620631951TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR862527.1:691463398-691463412
TACTGGTATGGCTTACTTTTGCGCCCCCAT691463398TTCATTGACAACATTCAGGTGGACCACATATGCAACCGAGCCTTG
Triticum aestivum genome assembly, chromosome: 7B.
LR862527.1:735540165-735540179
ATAGCCCGGCTACAGAAACTGGTGCGCCTA735540165TTCATTGACAACATTTACTTCGTGTTTCCTGCTGATATGTTTGGG
Triticum aestivum genome assembly, chromosome: 7D.
LR862528.1:3831995-3832009
GAACTGATCACCCATTTTATTATACATCTT3831995TTCATTGACAACATTCAAAACTGAAAGCGTCTCTTCACGGATGTT
Triticum aestivum genome assembly, chromosome: 7D.
LR862528.1:566066865-566066879
CCATAAGCAGAAAACCAAAGACTGTCCCCC566066865TTCATTGACAACATTGCTTCCGATGAGTCGGTTTGAACAATGATA
Triticum aestivum genome assembly, chromosome: 1A.
LR862529.1:400792246-400792260
CCATGTACAGTACTCTTCCGACAGAAGTCG400792246TTCATTGACAACATTGACCACGCCATGCCAAGAGCACCAGGGCGG
Triticum aestivum genome assembly, chromosome: 1B.
LR862530.1:320439145-320439159
AAAGTTGTCCATCGGTCTGCCCTATACCAG320439145TTCATTGACAACATTCTATACAGAAAAAGACTAAACAAAGTGAAA
Triticum aestivum genome assembly, chromosome: 1D.
LR862531.1:60048585-60048599
CCACGTACAGTACTCTTCCGATGGAAGTCG60048585TTCATTGACAACATTGACCACGCCGCGCTGAGAGCACCAGGGTGG
Triticum aestivum genome assembly, chromosome: 3A.
LR862535.1:122216218-122216232
GAAATGATCACCCATTTTATTATACAACTT122216218TTCATTGACAACATTCATAACTAAAAAGCGTCTCTTCACTGATGT
Triticum aestivum genome assembly, chromosome: 3A.
LR862535.1:657873874-657873888
CCGTGTACAGTCGTCTTCCGATGGATGTCG657873874TTCATTGACAACATTGACCACGCCGTGCCGATAGCACTAAGGCGG
Triticum aestivum genome assembly, chromosome: 3B.
LR862536.1:129868723-129868737
AAAGTAGCCCGCTGGTCTGCTCTGTACCAG129868723TTCATTGACAACATTCTGTACAGAAAAAGGCCGAATGGAGTGAAA
Triticum aestivum genome assembly, chromosome: 3B.
LR862536.1:577099359-577099373
AAAGTAGCCCGTCGGTCTGCCCTGTACCAG577099359TTCATTGACAACATTCTTCATAGAAGAAGACCAAATGGAGTGAAA
Triticum aestivum genome assembly, chromosome: 4A.
LR862538.1:621817168-621817182
CCTTAAAAGCAAACACTTATTTGCCTTCTT621817168TTCATTGACAACATTTAGATGGCCTTTAGTACTCTTTATCTACTT
Triticum aestivum genome assembly, chromosome: 4B.
LR862539.1:157106664-157106678
AAAGTAGCCCGACGGTCTGCCCTGTACCAG157106664TTCATTGACAACATTCTATACAGAAAAAGGCCAAACGGAGTGAGA
Triticum aestivum genome assembly, chromosome: 4B.
LR862539.1:321990460-321990474
CCGCGTACAATAATCTTTCGATGGCTGTCG321990460TTCATTGACAACATTGACCACACCACTCCGACAACACCCAGGTGG
Triticum aestivum genome assembly, chromosome: 4B.
LR862539.1:426078490-426078504
CCACGTACAGTCCACGTCCGATGGATGTCA426078490TTCATTGACAACATTGACCAGGCTGCACCGAGAGCACCATGGCGG
Triticum aestivum genome assembly, chromosome: 5A.
LR862541.1:660375437-660375451
TCTCCAGATTGTACAGCTGCAGCAAATTGA660375437TTCATTGACAACATTCTAATTAGTTTCATGCAACACCGTTTGCAG
Triticum aestivum genome assembly, chromosome: 5B.
LR862563.1:360681451-360681465
AAAGTAGCCCGCCGGTCTGCCCTGTATCAG360681451TTCATTGACAACATTCTATACAGAAAAATACCGAACGGGGTGAAA
Triticum aestivum genome assembly, chromosome: 6A.
LR862565.1:65270903-65270917
TACCATCCTTGCCCATCAATGATTTGTGTT65270903TTCATTGACAACATTCTTGCCTTCCCTCCAACACAAACTTCTTCG
Triticum aestivum genome assembly, chromosome: 6A.
LR862565.1:108669354-108669368
AACCCCTTTACTTTGAAGCTCACATAATCT108669354TTCATTGACAACATTTAGTATGCAAAATAGGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR862566.1:172933077-172933091
AACCCCTTTAGTTTGAACTTAACACAATCT172933077TTCATTGACAACATTCAGTATGTAAAATAAGTATAATCCGAATGT
Triticum aestivum genome assembly, chromosome: 6B.
LR862566.1:172976156-172976170
GAACCCTTTACTTTGAAGCTCACATAATCT172976156TTCATTGACAACATTTAGTATGCAAAATAAGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR862566.1:658349913-658349927
CCCTTCTCTGTCACCACAGTTCTACAAGAA658349913TTCATTGACAACATTTTCAAATTGCATGGCATGCCAGTGTCTATG
Triticum aestivum genome assembly, chromosome: 7A.
LR862568.1:11504031-11504045
GAACTGATTACCCATTTTATTATACATCTT11504031TTCATTGACAACATTCAAAACTGAAAGGGTCTCTTCACGGATGTT
Triticum aestivum genome assembly, chromosome: 7B.
LR862569.1:134052522-134052536
TGATTGTTTTCAGGTTTATGTATGTATTGT134052522TTCATTGACAACATTCCTCAAATATCAGGTAGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR862569.1:169890819-169890833
GATTGTTTTTCAGCTTTTTGTATGTATTGT169890819TTCATTGACAACATTCCTCAAATATCACTAATTATTTAGATTAAA
Triticum aestivum genome assembly, chromosome: 7B.
LR862569.1:283381196-283381210
AAAGTAGCCCGTCGGTCAAGCATGTACCAG283381196TTCATTGACAACATTCTGTACAGAAAAAGACCAAATGGGGTGAAA
Triticum aestivum genome assembly, chromosome: 7B.
LR862569.1:816563166-816563180
AAAGTAGCCCGCTGGTCTGCTTTGTATCAA816563166TTCATTGACAACATTTTGTACAGAAGGAGACCGAATGGGGTGAAA
Triticum aestivum genome assembly, chromosome: 7B.
LR862569.1:948889295-948889309
GGCAACCACCCGTGTCGCGGTCTCACTCTC948889295TTCATTGACAACATTTGCCACCCGATGACGCTCTAATTTGTCAAG
Triticum aestivum genome assembly, chromosome: 7D.
LR862570.1:1545721-1545735
GAACTGATCACCCATTTTATTATACATCTT1545721TTCATTGACAACATTCAAAACTGAAAGCGTCTCTTCACGGATGTT
Triticum aestivum genome assembly, chromosome: 7D.
LR862570.1:567349979-567349993
CCATAAGCAGAAAACCAAAGACTGTCCCCC567349979TTCATTGACAACATTGCTTCCGATGAGTCGGTTTGAACAATGATA
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR865395.1:308686299-308686313
GCATCCAAATAGGCAGAAACTTAGGAGAAT308686299TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTTAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR865397.1:14532174-14532188
CCCATAGTTTTTTAACAACAACATATTTTT14532174TTCATTGACAACATTTTACACAGAGTATTGTGAAATGTCTCACAC
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR865397.1:431592120-431592134
CGCTATGTAATGAGCTCCAACAATATTTTA431592120TTCATTGACAACATTTAGAGCCCATTTGGGACAGCTCTGCTCCTT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 4H.
LR865398.1:465899703-465899717
TCAGACCATGCCTGCCACACATTCAAAATG465899703TTCATTGACAACATTGGAGGGGGTGGCACACTTAGCGGTGCATCA
Triticum aestivum genome assembly, chromosome: 1A.
LR865458.1:398347744-398347758
CCATGTACAGTACTCTTCCGACAGAAGTCG398347744TTCATTGACAACATTGACCACGCCATGCCAAGAGCACCAGGGCGG
Triticum aestivum genome assembly, chromosome: 1D.
LR865460.1:59743149-59743163
CCACGTACAGTACTCTTCCGATGGAAGTCG59743149TTCATTGACAACATTGACCACGCCGCGCTGAGAGCACCAGGGTGG
Triticum aestivum genome assembly, chromosome: 2B.
LR865462.1:143205134-143205148
TATGATCTATATAAATATTATCACTTAAAA143205134TTCATTGACAACATTTCTTAAGAAAAGCAAATTATCCATTCACAA
Triticum aestivum genome assembly, chromosome: 2B.
LR865462.1:303702466-303702480
CAGAGCGCACAGTTAAACCCGGTCTGGTAA303702466TTCATTGACAACATTCACAACAACCGATGGTTATGCATCTAAATG
Triticum aestivum genome assembly, chromosome: 2B.
LR865462.1:483330609-483330623
AGCCATTGTCGGTGAAGTGGCGTCGTATTC483330609TTCATTGACAACATTCGCAACAACAGTTGCAGCCGAAGATGAATA
Triticum aestivum genome assembly, chromosome: 3A.
LR865464.1:119053998-119054012
GAAATGATCACCCATTTTATTATACAACTT119053998TTCATTGACAACATTCATAACTAAAAAGCGTCTCTTCACTGATGT
Triticum aestivum genome assembly, chromosome: 3A.
LR865464.1:373272461-373272475
CCGTATATAGTCGTCTTTCGATGGCTGTCA373272461TTCATTGACAACATTGACAACGCCGCACCGAGAGCACCAAGGCGG
Triticum aestivum genome assembly, chromosome: 3A.
LR865464.1:651862265-651862279
CCGTGTACAGTTGTCTTCCGATGGATGTCG651862265TTCATTGACAACATTGACCACGCCGTGCCGATAGCACTAAGGCGG
Triticum aestivum genome assembly, chromosome: 3B.
LR865465.1:135594738-135594752
AAAGTAGCCCGCTGGTCTGCTCTGTACCAG135594738TTCATTGACAACATTCTGTACAGAAAAAGGCCGAATGGAGTGAAA
Triticum aestivum genome assembly, chromosome: 3B.
LR865465.1:769961291-769961305
TCGCCTCTGTTGCGCAAGGGTGTGCTTGTA769961291TTCATTGACAACATTCTGGTATAATGAAGATATCATTTTAATTTT
Triticum aestivum genome assembly, chromosome: 4B.
LR865468.1:157112385-157112399
AAAGTAGCCCGACGGTCTGCCCTGTACCAG157112385TTCATTGACAACATTCTATACAGAAAAAGGCCAAACGGAGTGAGA
Triticum aestivum genome assembly, chromosome: 4B.
LR865468.1:196824935-196824949
AAAGTATCTCGTCGGTCCGCCATGTACCAG196824935TTCATTGACAACATTCTGTACAGAAAAAGAACGAATGGTGTGAAA
Triticum aestivum genome assembly, chromosome: 4B.
LR865468.1:327897222-327897236
AGAGTAGCCCGCCAGTCTACTCTATACCAG327897222TTCATTGACAACATTCTGTACAGAAAAAGACCAAATGGAGTGAAA
Triticum aestivum genome assembly, chromosome: 4B.
LR865468.1:431271120-431271134
CCACGTACAGTCCACGTCCGATGGATGTCA431271120TTCATTGACAACATTGACCAGGCTGCACCGAGAGCACCATGGCGG
Triticum aestivum genome assembly, chromosome: 5A.
LR865470.1:658203938-658203952
TCTCCAGATTGTACAGCTGCAGCAAATTGA658203938TTCATTGACAACATTCTAATTAGTTTCATGCAACACCGTTTGCAG
Triticum aestivum genome assembly, chromosome: 5B.
LR865471.1:535568274-535568288
AAAGTAGCCCGCTGGTCTGCTTTGTATCAA535568274TTCATTGACAACATTTTGTACAGAAGGAGACCGAATGGGGTGAAA
Triticum aestivum genome assembly, chromosome: 6A.
LR865473.1:107167068-107167082
AACCCCTTTACTTTGAAGCTCACATAATCT107167068TTCATTGACAACATTTAGTATGCAAAATAGGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR865474.1:171009235-171009249
GAACCCTTTACTTTGAAGCTCACATAATCT171009235TTCATTGACAACATTTAGTATGCAAAATAAGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR865474.1:597449715-597449729
AAAGTAGCCCGTTGGTCTGCCATGTATCAG597449715TTCATTGACAACATTCTGTACAGAAAAAGACTAAACGGTGTGAAA
Triticum aestivum genome assembly, chromosome: 6B.
LR865474.1:651694687-651694701
CCCTTCTCTGTCACCACAGTTCTACAAGAA651694687TTCATTGACAACATTTTCAAATTGCTTGGCATGCTAGTGTCTATG
Triticum aestivum genome assembly, chromosome: 7A.
LR865476.1:7410267-7410281
GAACTGATTACCCATTTTATTATACATCTT7410267TTCATTGACAACATTCAAAACTGAAAGGGTCTCTTCACGGATGTT
Triticum aestivum genome assembly, chromosome: 7B.
LR865477.1:192526899-192526913
CCGTGTATAGTCGTCTTCCGATGGCTGTCG192526899TTCATTGACAACATTGAACATGCTGCGCCGAGAGCACCAAGGCGG
Triticum aestivum genome assembly, chromosome: 7B.
LR865477.1:612196981-612196995
TGATTGTTTTCAGGTTTATGTATGTATTGT612196981TTCATTGACAACATTCCTCAAATATCAGGTAGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR865477.1:612238039-612238053
TGATTGTTTTCAGGTTTATGTATGTATTGT612238039TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR865477.1:612270209-612270223
TGATTGTTTTCAGGTTTATGTATGTATTGT612270209TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR865477.1:680175763-680175777
TACTGGTATGGCTTACTTTTGCGCCCCCAT680175763TTCATTGACAACATTCAGGTGGACCACATATGCAACTGAGCCTTG
Triticum aestivum genome assembly, chromosome: 7D.
LR865478.1:4143708-4143722
GAACTGATCACCCATTTTATTATACATCTT4143708TTCATTGACAACATTCAAAACTGAAAGCGTCTCTTCACGGATGTT
Triticum aestivum genome assembly, chromosome: 7D.
LR865478.1:564857752-564857766
CCATAAGCAGAAAACCAAAGACTGTCCCCC564857752TTCATTGACAACATTGCTTCCGATGAGTCGGTTTGAACAATGATA
Triticum aestivum genome assembly, chromosome: 1A.
LR865479.1:403381007-403381021
CCATGTACAGTACTCTTCCGACAGAAGTCG403381007TTCATTGACAACATTGACCACGCCATGCCAAGAGCACCAGGGCGG
Triticum aestivum genome assembly, chromosome: 1D.
LR865481.1:60532853-60532867
CCACGTACAGTACTCTTCCGATGGAAGTCG60532853TTCATTGACAACATTGACCACGCCGCGCTGAGAGCACCAGGGTGG
Triticum aestivum genome assembly, chromosome: 2B.
LR865483.1:146516276-146516290
TATGATCTATATAAATATTATCACTTAAAA146516276TTCATTGACAACATTTCTTAAGAAAAGCAAATTATCCATTCACAA
Triticum aestivum genome assembly, chromosome: 2B.
LR865483.1:306965968-306965982
CAGAGCGCACAGTTAAACCCGGTCTGGTAA306965968TTCATTGACAACATTCACAACAACCGATGGTTATGCATCTAAATG
Triticum aestivum genome assembly, chromosome: 5A.
LR865512.1:663866379-663866393
TCTCCAGATTGTACAGCTGCAGCAAATTGA663866379TTCATTGACAACATTCTAATTAGTTTCATGCAACACCGTTTCCAG
Triticum aestivum genome assembly, chromosome: 5B.
LR865513.1:563324653-563324667
AAAGTAGCCCGCTGGTCTGCTTTGTATCAA563324653TTCATTGACAACATTTTGTACAGAAGGAGACCGAATGGGGTGAAA
Triticum aestivum genome assembly, chromosome: 5B.
LR865513.1:699909196-699909210
GGCAACCACCCGTGTCGCGGTCTCACTCTC699909196TTCATTGACAACATTTGCCACCCGATGACGCTCTAATTTGTCAAG
Triticum aestivum genome assembly, chromosome: 6A.
LR865515.1:63000743-63000757
TACCATCCTTGCCCATCAATGATTTGTGTT63000743TTCATTGACAACATTCTTGCCTTCCCTCCAACACAAACTTCTTCG
Triticum aestivum genome assembly, chromosome: 6A.
LR865515.1:106746358-106746372
AACCCCTTTACTTTGAAGCTCACATAATCT106746358TTCATTGACAACATTTAGTATGCAAAATAGGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR865516.1:177211605-177211619
AACCCCTTTAGTTTGAACTTAACACAATCT177211605TTCATTGACAACATTCAGTATGTAAAATAAGTATAATCCGAATGT
Triticum aestivum genome assembly, chromosome: 6B.
LR865516.1:177254955-177254969
GAACCCTTTACTTTGAAGCTCACATAATCT177254955TTCATTGACAACATTTAGTATGCAAAATAAGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR865516.1:672746913-672746927
CCCTTCTCTGTCACCACAGTTCTACAAGAA672746913TTCATTGACAACATTTTCAAATTGCATGGCATGCCAGTGTCTATG
Triticum aestivum genome assembly, chromosome: 7A.
LR865518.1:11941577-11941591
TGAACTGATCACCATTTTATTATTCATATT11941577TTCATTGACAACATTCAAAACTGAAAGTGTCTCTTCACGGATGTT
Triticum aestivum genome assembly, chromosome: 7B.
LR865519.1:194569894-194569908
CCGTGTATAGTCGTCTTCCGATGGCTGTCG194569894TTCATTGACAACATTGAACATGCTGCGCTGAGAGCACCAAGGCGG
Triticum aestivum genome assembly, chromosome: 7B.
LR865519.1:619692797-619692811
TGATTGTTTTCAGGTTTATGTATGTATTGT619692797TTCATTGACAACATTCCTCAAATATCAGGTAGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR865519.1:619733837-619733851
TGATTGTTTTCAGGTTTATGTATGTATTGT619733837TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR865519.1:619766008-619766022
TGATTGTTTTCAGGTTTATGTATGTATTGT619766008TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR865519.1:691575042-691575056
TACTGGTATGGCTTACTTTTGCGCCCCCAT691575042TTCATTGACAACATTCAGGTGGACCACATATGCAACCGAGCCTTG
Triticum aestivum genome assembly, chromosome: 7D.
LR865520.1:4143749-4143763
GAACTGATCACCCATTTTATTATACATCTT4143749TTCATTGACAACATTCAAAACTGAAAGCGTCTCTTCACGGATGTT
Triticum aestivum genome assembly, chromosome: 7D.
LR865520.1:568970554-568970568
CCATAAGCAGAAAACCAAAGACTGTCCCCC568970554TTCATTGACAACATTGCTTCCGATGAGTCGGTTTGAACAATGATA
Triticum aestivum genome assembly, chromosome: 1A.
LR865739.1:399605982-399605996
CCATGTACAGTACTCTTCCGACAGAAGTCG399605982TTCATTGACAACATTGACCACGCCATGCCAAGAGCACCAGGGCGG
Triticum aestivum genome assembly, chromosome: 1D.
LR865741.1:62247607-62247621
CCACGTACAGTACTCTTCCGATGGAAGTCG62247607TTCATTGACAACATTGACCACGCCGCGCTGAGAGCACCAGGGTGG
Triticum aestivum genome assembly, chromosome: 2B.
LR865743.1:142915735-142915749
TATGATCTATATAAATATTATCACTTAAAA142915735TTCATTGACAACATTTCTTAAGAAAAGCAAATTGTCCATTCACAA
Triticum aestivum genome assembly, chromosome: 2B.
LR865743.1:493685782-493685796
AGCCATTGTCGGTGAAGTGGCGTCGTATTC493685782TTCATTGACAACATTCGCAACAACAGTTGCAGCCGAAGATGAATA
Triticum aestivum genome assembly, chromosome: 3A.
LR865745.1:127271089-127271103
GAAATGATCACCCATTTTATTATACAACTT127271089TTCATTGACAACATTCATAACTAAAAAGCGTCTCTTCACTGATGT
Triticum aestivum genome assembly, chromosome: 3A.
LR865745.1:387534988-387535002
CCGTATATAGTCGTCTTTCGATGGCTGTCA387534988TTCATTGACAACATTGACAACGCCGCACCGAGAGCACCAAGGCGG
Triticum aestivum genome assembly, chromosome: 3A.
LR865745.1:668707128-668707142
CCGTGTACAGTCGTCTTCCGATGGATGTCG668707128TTCATTGACAACATTGACCACGCCGTGCCGATAGCACTAAGGCGG
Triticum aestivum genome assembly, chromosome: 3B.
LR865746.1:135213454-135213468
AAAGTAGACCGCTGGTCTGCTCTGTACCAG135213454TTCATTGACAACATTCTGTACAGAAAAAGGCCGAATGGAGTGAAA
Triticum aestivum genome assembly, chromosome: 3B.
LR865746.1:144621753-144621767
CCTTTTACTGTCAAGAGTGTTGCTCAAGTT144621753TTCATTGACAACATTATCAAGTTGCATGGTCCTCCAATTGCTATC
Triticum aestivum genome assembly, chromosome: 3B.
LR865746.1:588002013-588002027
AAAGTAGCCCGTCGGTCTGCCCTGTACCAG588002013TTCATTGACAACATTCTTCATAGAAGAAGACCAAATGGAGTGAAA
Triticum aestivum genome assembly, chromosome: 4B.
LR865749.1:159345444-159345458
AAAGTAGCCCGACGGTCTGCCCTGTACCAG159345444TTCATTGACAACATTCTATACAGAAAAAGGCCAAACGGAGTGAGA
Triticum aestivum genome assembly, chromosome: 4B.
LR865749.1:201205247-201205261
AAAGTATCTCGTCGGTCCGCCATGTACCAG201205247TTCATTGACAACATTCTGTACAGAAAAAGAACGAATGGTGTGAAA
Triticum aestivum genome assembly, chromosome: 4B.
LR865749.1:345240747-345240761
CCGCGTACAATAATCTTTCGATGGCTGTCG345240747TTCATTGACAACATTGACCACACCACTCCGACAACACCCAGGTGG
Triticum aestivum genome assembly, chromosome: 4B.
LR865749.1:353675073-353675087
GAAATGATCACCCATTTTATTATACTACTT353675073TTCATTGACAACATTCATAACTAAAAAGCGTCTCTTCACTGATGT
Triticum aestivum genome assembly, chromosome: 4B.
LR865749.1:451731402-451731416
CCACGTACAGTCCACGTCCGATGGATGTCA451731402TTCATTGACAACATTGACCAGGCTGCACCGAGAGCACCATGGCGG
Triticum aestivum genome assembly, chromosome: 5A.
LR865751.1:669054743-669054757
TCTCCAGATTGTACAGCTGCAGCAAATTGA669054743TTCATTGACAACATTCTAATTAGTTTCATGCAACACCGTTTGCAG
Triticum aestivum genome assembly, chromosome: 5B.
LR865752.1:553434523-553434537
AAAGTAGCCCGCTGGTCTGCTTTGTATCAA553434523TTCATTGACAACATTTTGTACAGAAGGAGACCGAATGGGGTGAAA
Triticum aestivum genome assembly, chromosome: 6A.
LR865754.1:65359934-65359948
TACCATCCTTGCCCATCAATGATTTGTGTT65359934TTCATTGACAACATTCTTGCCTTCCCTCCAACACAAACTTCTTCG
Triticum aestivum genome assembly, chromosome: 6A.
LR865754.1:109247477-109247491
AACCCCTTTACTTTGAAGCTCACATAATCT109247477TTCATTGACAACATTTAGTATGCAAAATAGGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR865755.1:175791834-175791848
AACCCCTTTAGTTTGAACTTAACACAATCT175791834TTCATTGACAACATTCAGTATGTAAAATAAGTATAATCCGAATGT
Triticum aestivum genome assembly, chromosome: 6B.
LR865755.1:175835376-175835390
GAACCCTTTACTTTGAAGCTCACATAATCT175835376TTCATTGACAACATTTAGTATGCAAAATAAGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR865755.1:602140648-602140662
AAAGTAGCCCGTTGGTCTGCCATGTATCAG602140648TTCATTGACAACATTCTGTACAGAAAAAGACTAAACGGTGTGAAA
Triticum aestivum genome assembly, chromosome: 6B.
LR865755.1:656602614-656602628
CCCTTCTCTGTCACCACAGTTCTACAAGAA656602614TTCATTGACAACATTTTCAAATTGCTTGGCATGCTAGTGTCTATG
Triticum aestivum genome assembly, chromosome: 7A.
LR865757.1:13712911-13712925
GAACTGATTACCCATTTTATTATACATCTT13712911TTCATTGACAACATTCAAAACTGAAAGGGTCTCTTCACGGATGTT
Triticum aestivum genome assembly, chromosome: 7B.
LR865758.1:197159270-197159284
CCGTGTATAGTCGTCTTCCGATGGCTGTCG197159270TTCATTGACAACATTGAACATGCTGCGCTGAGAGCACCAAGGCGG
Triticum aestivum genome assembly, chromosome: 7B.
LR865758.1:623586479-623586493
TGATTGTTTTCAGGTTTATGTATGTATTGT623586479TTCATTGACAACATTCCTCAAATATCAGGTAGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR865758.1:623627706-623627720
TGATTGTTTTCAGGTTTATGTATGTATTGT623627706TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR865758.1:623660069-623660083
TGATTGTTTTCAGGTTTATGTATGTATTGT623660069TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR865758.1:695893673-695893687
TACTGGTATGGCTTACTTTTGCGCCCCCAT695893673TTCATTGACAACATTCAGGTGGACCACATATGCAACCGAGCCTTG
Triticum aestivum genome assembly, chromosome: 7D.
LR865759.1:3919619-3919633
GAACTGATCACCCATTTTATTATACATCTT3919619TTCATTGACAACATTCAAAACTGAAAGCGTCTCTTCACGGATGTT
Triticum aestivum genome assembly, chromosome: 1A.
LR865760.1:405135217-405135231
CCATGTACAGTACTCTTCCGACAGAAGTCG405135217TTCATTGACAACATTGACCACGCCATGCCAAGAGCACCAGGGCGG
Triticum aestivum genome assembly, chromosome: 1D.
LR865762.1:58944723-58944737
CCACGTACAGTACTCTTCCGATGGAAGTCG58944723TTCATTGACAACATTGACCACGCCGCGCTGAGAGCACCAGGGTGG
Triticum aestivum genome assembly, chromosome: 2B.
LR865764.1:308223762-308223776
CAGAGCGCACAGTTAAACCCGGTCTGGTAA308223762TTCATTGACAACATTCACAACAACCGATGGTTATGCATCTAAATG
Triticum aestivum genome assembly, chromosome: 2B.
LR865764.1:490459793-490459807
AGCCATTGTCGGTGAAGTGGCGTCGTATTC490459793TTCATTGACAACATTCGCAACAACAGTTGCAGCCGAAGATGAATA
Triticum aestivum genome assembly, chromosome: 6A.
LR877324.1:42395789-42395803
CTATATAATGGTGGCCAGAGCACATGTTAT42395789TTCATTGACAACATTAGGCATGGCAAACATCAGAAAGAGTGCAAG
Triticum aestivum genome assembly, chromosome: 6A.
LR877324.1:106622232-106622246
AACCCCTTTACTTTGAAGCTCACATAATCT106622232TTCATTGACAACATTTAGTATGCAAAATAGGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR877325.1:175470040-175470054
AACCCCTTTAGTTTGAACTTAACACAATCT175470040TTCATTGACAACATTCAGTATGTAAAATAAGTATAATCCGAATGT
Triticum aestivum genome assembly, chromosome: 6B.
LR877325.1:175513458-175513472
GAACCCTTTACTTTGAAGCTCACATAATCT175513458TTCATTGACAACATTTAGTATGCAAAATAAGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR877325.1:595932894-595932908
AAAGTAGCCCGTTGGTCTGCCATGTATCAG595932894TTCATTGACAACATTCTGTACAGAAAAAGACTAAACGGTGTGAAA
Triticum aestivum genome assembly, chromosome: 6B.
LR877325.1:650407131-650407145
CCCTTCTCTGTCACCACAGTTCTACAAGAA650407131TTCATTGACAACATTTTCAAATTGCATGGCATGCCAGTGTCTATG
Triticum aestivum genome assembly, chromosome: 7B.
LR877328.1:196067732-196067746
CCGTGTATAGTCGTCTTCCGATGGCTGTCG196067732TTCATTGACAACATTGAACATGCTGCGCTGAGAGCACCAAGGCGG
Triticum aestivum genome assembly, chromosome: 7B.
LR877328.1:626581708-626581722
TGATTGTTTTCAGGTTTATGTATGTATTGT626581708TTCATTGACAACATTCCTCAAATATCAGGTAGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR877328.1:626654854-626654868
TGATTGTTTTCAGGTTTATGTATGTATTGT626654854TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7D.
LR877329.1:3897114-3897128
GAACTGATCACCCATTTTATTATACATCTT3897114TTCATTGACAACATTCAAAACTGAAAGCGTCTCTTCACGGATGTT
Triticum aestivum genome assembly, chromosome: 7D.
LR877329.1:568647726-568647740
CCATAAGCAGAAAACCAAAGACTGTCCCCC568647726TTCATTGACAACATTGCTTCCGATGAGTCGGTTTGAACAATGATA
Triticum aestivum genome assembly, chromosome: 1B.
LR878436.1:234021323-234021337
AACGTAGTCCATTGGTCTGCCATGTATCAG234021323TTCATTGACAACATTCTGTACAGAAAAAGACCAAATGGTGTGAAA
Triticum aestivum genome assembly, chromosome: 1B.
LR878436.1:322594688-322594702
AAAGTTGTCCATCGGTCTGCCCTATACCAG322594688TTCATTGACAACATTCTATACAGAAAAAGACTAAACAAAGTGAAA
Triticum aestivum genome assembly, chromosome: 1D.
LR878437.1:60958916-60958930
CCACGTACAGTACTCTTCCGATGGAAGTCG60958916TTCATTGACAACATTGACCACGCCGCGCTGAGAGCACCAGGGTGG
Triticum aestivum genome assembly, chromosome: 2B.
LR878439.1:147258715-147258729
TATGATCTATATAAATATTATCACTTAAAA147258715TTCATTGACAACATTTCTTAAGAAAAGCAAATTATCCATTCACAA
Triticum aestivum genome assembly, chromosome: 2B.
LR878439.1:310710331-310710345
CAGAGCGCACAGTTAAACCCGGTCTGGTAA310710331TTCATTGACAACATTCACAACAACCGATGGTTATGCATCTAAATG
Triticum aestivum genome assembly, chromosome: 2B.
LR878439.1:492935700-492935714
AGCCATTGTCGGTGAAGTGGCGTCGTATTC492935700TTCATTGACAACATTCGCAACAACAGTTGCAGCCGAAGATGAATA
Triticum aestivum genome assembly, chromosome: 2B.
LR878439.1:582558075-582558089
AGCCATGGTCGGTGAAGTGGCGTCGTCTTC582558075TTCATTGACAACATTCGCAACAACAGTTGCAGCTGAAGATGAATA
Triticum aestivum genome assembly, chromosome: 3A.
LR878441.1:129106070-129106084
GAAATGATCACCCATTTTATTATACAACTT129106070TTCATTGACAACATTCATAACTAAAAAGCGTCTCTTCACTGATGT
Triticum aestivum genome assembly, chromosome: 3A.
LR878441.1:666394794-666394808
CCGTGTACAGTCGTCTTCCGATGGATGTCG666394794TTCATTGACAACATTGACCACGCCGTGCCGATAGCACTAAGGCGG
Triticum aestivum genome assembly, chromosome: 3B.
LR878442.1:131629729-131629743
AAAGTAGACCGCTGGTCTGCTCTGTACCAG131629729TTCATTGACAACATTCTGTACAGAAAAAGGCCGAATGGAGTGAAA
Triticum aestivum genome assembly, chromosome: 3B.
LR878442.1:140921207-140921221
CCTTTTACTGTCAAGAGTGTTGCTCAAGTT140921207TTCATTGACAACATTATCAAGTTGCATGGTCCTCCAATTGCTATC
Triticum aestivum genome assembly, chromosome: 3B.
LR878442.1:391420765-391420779
GAAACATGGTCATCATATGTTACGGCATTT391420765TTCATTGACAACATTGACATGTGAGTTCATTTTTAAGTTAATGGA
Triticum aestivum genome assembly, chromosome: 3D.
LR878443.1:261071935-261071949
CTGTGTACAGTCGTCTTTTGATGGCTGTCG261071935TTCATTGACAACATTGACCACGCCGCGTGGAGAGCACCAAGGCGG
Triticum aestivum genome assembly, chromosome: 4B.
LR878445.1:158356297-158356311
AAAGTAGCCCGACGGTCTGCCCTGTACCAG158356297TTCATTGACAACATTCTATACAGAAAAAGGCCAAACGGAGTGAGA
Triticum aestivum genome assembly, chromosome: 4B.
LR878445.1:198383428-198383442
AAAGTATCTCGTCGGTCCGCCATGTACCAG198383428TTCATTGACAACATTCTGTACAGAAAAAGAACGAATGGTGTGAAA
Triticum aestivum genome assembly, chromosome: 4B.
LR878445.1:247281195-247281209
CCGCGTACAATAATCTTTCGATGGCTGTCG247281195TTCATTGACAACATTGACCACACCACTCCGACAACACCCAGGTGG
Triticum aestivum genome assembly, chromosome: 4B.
LR878445.1:255696333-255696347
GAAATGATCACCCATTTTATTATACTACTT255696333TTCATTGACAACATTCATAACTAAAAAGCGTCTCTTCACTGATGT
Triticum aestivum genome assembly, chromosome: 4B.
LR878445.1:312429288-312429302
AGAGTAGCCCGCCAGTCTACTCTATACCAG312429288TTCATTGACAACATTCTGTACAGAAAAAGACCAAATGGAGTGAAA
Triticum aestivum genome assembly, chromosome: 4B.
LR878445.1:430051364-430051378
CCACGTACAGTCCACGTCCGATGGATGTCA430051364TTCATTGACAACATTGACCAGGCTGCACCGAGAGCACCATGGCGG
Triticum aestivum genome assembly, chromosome: 5A.
LR878447.1:432463953-432463967
ATGAAATTTATGGACAAATTTGTTGTGGTG432463953TTCATTGACAACATTCTGGTATACTCTAAGACACCAGAAGAGCAT
Triticum aestivum genome assembly, chromosome: 5A.
LR878447.1:668360756-668360770
TCTCCAGATTGTACAGCTGCAGCAAATTGA668360756TTCATTGACAACATTCTAATTAGTTTCATGCAACACCGTTTGCAG
Triticum aestivum genome assembly, chromosome: 5B.
LR878448.1:552242550-552242564
AAAGTAGCCCGCTGGTCTGCTTTGTATCAA552242550TTCATTGACAACATTTTGTACAGAAGGAGACCGAATGGGGTGAAA
Triticum aestivum genome assembly, chromosome: 5D.
LR878449.1:3180797-3180811
CCACGTACAGTACTCTTCCGATGGAAGTCG3180797TTCATTGACAACATTGACCACGCCGCGTCGAGTGCACCAAGGCGG
Triticum aestivum genome assembly, chromosome: 6A.
LR878450.1:67173215-67173229
TACCATCCTTGCCCATCAATGATTTGTGTT67173215TTCATTGACAACATTCTTGCCTTCCCTCCAACACAAACTTCTTCG
Triticum aestivum genome assembly, chromosome: 6A.
LR878450.1:110652380-110652394
AACCCCTTTACTTTGAAGCTCACATAATCT110652380TTCATTGACAACATTTAGTATGCAAAATAGGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR878451.1:169969901-169969915
AACCCCTTTAGTTTGAACTTAACACAATCT169969901TTCATTGACAACATTCAGTATGTAAAATAAGTATAATCCGAATGT
Triticum aestivum genome assembly, chromosome: 6B.
LR878451.1:170013349-170013363
GAACCCTTTACTTTGAAGCTCACATAATCT170013349TTCATTGACAACATTTAGTATGCAAAATAAGCATAATCCGAGTGT
Triticum aestivum genome assembly, chromosome: 6B.
LR878451.1:659402578-659402592
CCCTTCTCTGTCACCACAGTTCTACAAGAA659402578TTCATTGACAACATTTTCAAATTGCATGGCATGCCAGTGTCTATG
Triticum aestivum genome assembly, chromosome: 7B.
LR878454.1:196092722-196092736
CCGTGTATAGTCGTCTTCCGATGGCTGTCG196092722TTCATTGACAACATTGAACATGCTGCGCTGAGAGCACCAAGGCGG
Triticum aestivum genome assembly, chromosome: 7B.
LR878454.1:623238333-623238347
TGATTGTTTTCAGGTTTATGTATGTATTGT623238333TTCATTGACAACATTCCTCAAATATCAGGTAGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR878454.1:623279275-623279289
TGATTGTTTTCAGGTTTATGTATGTATTGT623279275TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR878454.1:623311431-623311445
TGATTGTTTTCAGGTTTATGTATGTATTGT623311431TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum aestivum genome assembly, chromosome: 7B.
LR878454.1:693063682-693063696
TACTGGTATGGCTTACTTTTGCGCCCCCAT693063682TTCATTGACAACATTCAGGTGGACCACATATGCAACCGAGCCTTG
Triticum aestivum genome assembly, chromosome: 7D.
LR878455.1:3623378-3623392
GAACTGATCACCCATTTTATTATACATCTT3623378TTCATTGACAACATTCAAAACTGAAAGCGTCTCTTCACGGATGTT
Triticum aestivum genome assembly, chromosome: 7D.
LR878455.1:562053068-562053082
CCATAAGCAGAAAACCAAAGACTGTCCCCC562053068TTCATTGACAACATTGCTTCCGATGAGTCGGTTTGAACAATGATA
Arabidopsis thaliana genome assembly, chromosome: 5.
LR881470.1:2852717-2852731
CGTGATGCTGAAGGCCAAGATGTCTTGCTT2852717TTCATTGACAACATTTTCCGTTTCACTCAGGTAAGCCTTGTTATG
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 1H.
LR890096.1:320474908-320474922
GCATCCAAATAGGCAGAAACTTAGGAGAAT320474908TTCATTGACAACATTGAAGAAAGGGATAGAGCTGGTTTTTAGTAT
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR890098.1:17395224-17395238
CCCATAGTTTTTTAACAACAACATATTTTT17395224TTCATTGACAACATTTTACACAGAGTATTGTGAAATGTCTCACAC
Hordeum vulgare subsp. vulgare genome assembly, chromosome: 3H.
LR890098.1:442857369-442857383
CGCTATGTAATGAGCTCCAACAATATTTTA442857369TTCATTGACAACATTTAGAGCCCATTTGGGACAGCTCTGCTCCTT
Arabis alpina genome assembly, chromosome: 8.
LT669795.1:5520129-5520143
CGTGATGCCGAAGGCCAAGATGTGTTGCTT5520129TTCATTGACAACATTTTCCGTTTCACCCAGGTCCTTGTTGTTCCA
Arabis alpina genome assembly, chromosome: 8.
LT669795.1:5523644-5523658
CGTGATGCTGAAGGCCAAGATGTGTTGCTT5523644TTCATTGACAACATTTTCCGTTTCACCCAGGTGAGTCTTGTTTCT
Arabis alpina genome assembly, chromosome: 8.
LT669795.1:41616710-41616724
TGTCTCATAGAATAAATTAGTCTCCAATCA41616710TTCATTGACAACATTTTTGAGAAAAAAAAACATTAACTTAAATTA
Malassezia sympodialis isolate KS024 genome assembly, chromosome: 3.
LT671791.1:1095484-1095498
CGTGACGACGAGGGCCAGGATGTGCTGCTG1095484TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCGGAGACT
Malassezia sympodialis isolate KS327 genome assembly, chromosome: 3.
LT671799.1:1093144-1093158
CGTGACGACGAGGGCCAGGATGTGCTGCTG1093144TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCGGAGACT
Malassezia sympodialis isolate KS004 genome assembly, chromosome: 3.
LT671807.1:1092506-1092520
CGTGACGACGAGGGCCAGGATGTGCTGCTG1092506TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCGGAGACT
Malassezia sympodialis isolate KS292 genome assembly, chromosome: 3.
LT671815.1:1095052-1095066
CGTGACGACGAGGGCCAGGATGTGCTGCTG1095052TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCGGAGACT
Malassezia sympodialis ATCC 42132 genome assembly, chromosome: 3.
LT671823.1:1092631-1092645
CGTGACGACGAGGGCCAGGATGTGCTGCTG1092631TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCGGAGACT
Triticum turgidum subsp. durum genome assembly, chromosome: 1A.
LT934111.1:391588053-391588067
CCATGTACAGTACTCTTCCGACAGAAGTCG391588053TTCATTGACAACATTGACCACGCCATGCCAAGAGCACCAGGGCGG
Triticum turgidum subsp. durum genome assembly, chromosome: 1B.
LT934112.1:101384913-101384927
AAAGTAGCCCGCCAGTCTGCTCTGTACCAG101384913TTCATTGACAACATTCTGTACAGAAAAAGACAGAATGGAGTGAAA
Triticum turgidum subsp. durum genome assembly, chromosome: 1B.
LT934112.1:223082377-223082391
AACGTAGTCCATTGGTCTGCCATGTATCAG223082377TTCATTGACAACATTCTGTACAGAAAAAGACCAAATGGTGTGAAA
Triticum turgidum subsp. durum genome assembly, chromosome: 1B.
LT934112.1:307672721-307672735
AAAGTAGTCCATCGGTCTGCCCTATACCAG307672721TTCATTGACAACATTCTATACAGAAAAAGACTAAACAAAGTGAAA
Triticum turgidum subsp. durum genome assembly, chromosome: 2B.
LT934114.1:304355326-304355340
CAGAGCGCACAGTTAAACCCGGTCTGGTAA304355326TTCATTGACAACATTCACAACAACCGATGGTTATGCATCTAAATG
Triticum turgidum subsp. durum genome assembly, chromosome: 2B.
LT934114.1:480489375-480489389
AGCCATTGTCGGTGAAGTGGCGTCGTATTC480489375TTCATTGACAACATTCGCAACAACAGTTGCAGCCGAAGATGAATA
Triticum turgidum subsp. durum genome assembly, chromosome: 2B.
LT934114.1:767349931-767349945
GAAATGATCACCCATTTTATTATACAACTT767349931TTCATTGACAACATTCATAACTAAAAAGCGTCTCTTCACTGATGT
Triticum turgidum subsp. durum genome assembly, chromosome: 3A.
LT934115.1:123147268-123147282
GAAATGATCACCCATTTTATTATACAACTT123147268TTCATTGACAACATTCATAACTAAAAAGCGTCTCTTCACTGATGT
Triticum turgidum subsp. durum genome assembly, chromosome: 3A.
LT934115.1:658218845-658218859
CCGTGTACAGTCGTCTTCCGATGGATGTCG658218845TTCATTGACAACATTGACCACGCCGTGCCGATAGCACTAAGGCGG
Triticum turgidum subsp. durum genome assembly, chromosome: 3B.
LT934116.1:130526818-130526832
AAAGTAGCCCGCTGGTCTGCTCTGTACCAG130526818TTCATTGACAACATTCTGTACAGAAAAAGGCCGAATGGAGTGAAA
Triticum turgidum subsp. durum genome assembly, chromosome: 3B.
LT934116.1:480287770-480287784
GTTTGGCAACTTAAGAGAAGGGATTTTCAA480287770TTCATTGACAACATTGCTAAGAGGCTTAAACAGAAGGAACATCAC
Triticum turgidum subsp. durum genome assembly, chromosome: 3B.
LT934116.1:563755378-563755392
AAAGTAGCCCGCCGGTCTGCCCTGTACCAG563755378TTCATTGACAACATTCTTCATAGAAGAAGACCAAATGGAGTGAAA
Triticum turgidum subsp. durum genome assembly, chromosome: 4B.
LT934118.1:101644420-101644434
AAAGTAGCCCACCGGTCCACTCTGTACCAA101644420TTCATTGACAACATTTTGTACAGAAAGAGACCAAATGGGTGAAAT
Triticum turgidum subsp. durum genome assembly, chromosome: 4B.
LT934118.1:156581492-156581506
AAAGTAGCCCGACGGTCTGCCCTGTACCAG156581492TTCATTGACAACATTCTATACAGAAAAAGGCCAAACGGAGTGAGA
Triticum turgidum subsp. durum genome assembly, chromosome: 4B.
LT934118.1:301046107-301046121
CCGCGTACAATAATCTTCCGATGGCTGTCG301046107TTCATTGACAACATTGACCACACCACTCCGACAACACCCAGGTGG
Triticum turgidum subsp. durum genome assembly, chromosome: 4B.
LT934118.1:309630520-309630534
GAAATGATCACCCATTTTATTATACTACTT309630520TTCATTGACAACATTCATAACTAAAAAGCGTCTCTTCACTGATGT
Triticum turgidum subsp. durum genome assembly, chromosome: 4B.
LT934118.1:525604833-525604847
AAAGTAGCCTGCCGGTCTGCTCTGTATCAA525604833TTCATTGACAACATTTTGTACAGACAGAGACCGAATGGGGTGAAA
Triticum turgidum subsp. durum genome assembly, chromosome: 5A.
LT934119.1:624864506-624864520
TCTCCAGATTGTACAGCTGCAGCAAATTGA624864506TTCATTGACAACATTCTAATTAGTTTCATGCAACACCGTTTGCAG
Triticum turgidum subsp. durum genome assembly, chromosome: 6A.
LT934121.1:105812822-105812836
AACCCCTTTACTTTGAAGCTCACATAATCT105812822TTCATTGACAACATTTAGTATGCAAAATAGGCATAATCCGAGTGT
Triticum turgidum subsp. durum genome assembly, chromosome: 6B.
LT934122.1:165244245-165244259
AACCCCTTTAGTTTGAACTTAACACAATCT165244245TTCATTGACAACATTCAGTATGTAAAATAAGTATAATCCGAATGT
Triticum turgidum subsp. durum genome assembly, chromosome: 6B.
LT934122.1:165287696-165287710
GAACCCTTTACTTTGAAGCTCACATAATCT165287696TTCATTGACAACATTTAGTATGCAAAATAAGCATAATCCGAGTGT
Triticum turgidum subsp. durum genome assembly, chromosome: 6B.
LT934122.1:586111816-586111830
AAAGTAGCCCGTTGGTCTGCCATGTATCAG586111816TTCATTGACAACATTCTATACAGAAAAAGACTAAACAGTGTGAAA
Triticum turgidum subsp. durum genome assembly, chromosome: 6B.
LT934122.1:642461547-642461561
CCCTTCTCTGTCACCACAGTTCTACAAGAA642461547TTCATTGACAACATTTTCAAATTGCTTGGCATGCTAGTGTCTATG
Triticum turgidum subsp. durum genome assembly, chromosome: 7A.
LT934123.1:3403721-3403735
GAACTGATCACCCATTTTATTATTCATCTT3403721TTCATTGACAACATTCAAAACTGAAAGTGTCTCTTCACGGATGTT
Triticum turgidum subsp. durum genome assembly, chromosome: 7B.
LT934124.1:118514831-118514845
AGAGTAGCCCGCCGGTCTGCTCTATACCAA118514831TTCATTGACAACATTTTGTACAGAAGGAGACCAAATGGGGTGAAA
Triticum turgidum subsp. durum genome assembly, chromosome: 7B.
LT934124.1:193307701-193307715
CCGTGTATAGTCGTCTTCCGATGGCTGTCG193307701TTCATTGACAACATTGAACATGCTGCACCGAGAGCACCAAGGCGG
Triticum turgidum subsp. durum genome assembly, chromosome: 7B.
LT934124.1:603919187-603919201
TGATTGTTTTCAGGTTTATGTATGTATTGT603919187TTCATTGACAACATTCCTCAAATATCAGGTAGTGCACATCACTAA
Triticum turgidum subsp. durum genome assembly, chromosome: 7B.
LT934124.1:603965027-603965041
TGATTGTTTTCAGGTTTATGTATGTATTGT603965027TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum turgidum subsp. durum genome assembly, chromosome: 7B.
LT934124.1:604001586-604001600
TGATTGTTTTCAGGTTTATGTATGTATTGT604001586TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum turgidum subsp. durum genome assembly, chromosome: 7B.
LT934124.1:604028290-604028304
TGATTGTTTTCAGGTTTATGTATGTATTGT604028290TTCATTGACAACATTCCTCAAATATCAGGTGGTGCACATCACTAA
Triticum turgidum subsp. durum genome assembly, chromosome: 7B.
LT934124.1:672408996-672409010
TACTGGTATGGCTTACTTTTGCGCCCCCAT672408996TTCATTGACAACATTCAGGTGGACCACATATGCAACTGAGCCTTG
N.crassa mitochondrial ATPase beta-subunit (ATP-2) gene, complete cds.
M84192.1:2745-2759
CCGTTGCTAACGCAGTCTGTAGTGTTGCTC2745TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Pisum sativum ascorbate peroxidase (ApxI) gene, complete cds.
M93051.1:2865-2879
ATGCCACCTTTTATCTATTTTATAAATCTC2865TTCATTGACAACATTATTAATAAATGTATAGTGAGTTGTTGACTG
Dictyochloris fragrans CF1 beta subunit of ATP synthase (atpB) gene, complete cds; chloroplast.
MG778236.1:873-887
CGAGATGTTAACAAGCAGGACGTTTTATTC873TTCATTGACAACATTTTTAGATTTGTACAAGCTGGTGCTGAGGTA
Botrytis fabae ATP synthase subunit beta isoform 2 mRNA, complete cds.
MK723972.1:923-937
AGAGACGAAGAAGGACAAGATGTCTTGCTC923TTCATTGACAACATTTTCAGGTTCACCCAAGCTGGTTCTGAGGTG
Polytaenium guayanense voucher TUR:Tuomisto 15684 ATP synthase beta chain (atpB) gene, partial cds; chloroplast.
MN781248.1:460-474
AGAGATATCAACAAGCGAGATGTACTCTTA460TTCATTGACAACATTTTCCGATTTGTACAGGCAGGATCTGAGGTC
UNVERIFIED: Antrophyum henryi plastid sequence.
MT130614.1:31205-31219
CGAGATATCAACAAGCGAGACGTACTCTTA31205TTCATTGACAACATTTTCCGATTTGTACAAGCAGGATCTGAGGTT
UNVERIFIED: Cryptogramma brunoniana plastid sequence.
MT130621.1:31790-31804
CGAGATATTAACAGGCAAGATGTACTCTTA31790TTCATTGACAACATTTTTCGCTTCGTTCAAGCGGGGTCGGAGGTA
UNVERIFIED: Azolla pinnata subsp. asiatica plastid sequence.
MT130631.1:31280-31294
CGAGATGTTAACAAGCAAGATGTACTTCCA31280TTCATTGACAACATTTTTCGTTTCGTCCAAGCGGGATCAGAAGTC
Viscum album ATP synthase beta subunit mRNA, complete cds.
MZ318194.1:1045-1059
CGTGATGTTGAGGGGCAAGATGTGCTCCTC1045TTCATTGACAACATTTTCCGCTTCACTCAAGCCAACTCTGAGGTT
Gracilaria isabellana voucher ALCB60808 chloroplast, complete genome.
MZ336060.1:81800-81814
AACAAGACTATGGACTTGATTGTTAAACAG81800TTCATTGACAACATTTTTTTTGACCTCTGTTGTAATTAAAGGATT
Gracilaria isabellana voucher ALCB60808 chloroplast, complete genome.
MZ336060.1:100140-100154
CGGGATATTAATAAGCAAGATGTACTGTTA100140TTCATTGACAACATTTTTCGATTTGTACAAGCAGGTTCTGAAGTT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ddbj125pln/TTCATTGACAACATT
lang : en | db : ddbj125pln | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.239 | 0.231 | search_plus_done; http://172.18.8.71:27707/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.497 | 0.258 | search_minus_done; http://172.18.8.71:27707/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=0
0.497 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).