GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-09-28 21:32:36, GGGenome : DDBJ release 92.0 (Feb, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Human BAC clone GS1-312P20 from 5p15.2, complete sequence.
AC002123.1:133597-133611
CCTGGGTATAATGCACTGATCTGCTGATCT133597GCCATCGACTTTGGAGCTGGAAAGGCCCTC
Human BAC clone CTB-191D16, complete sequence.
AC002460.1:73482-73496
CAGAATATATTATCGCTTTAAACACAGATT73482TTGTGGGCACCCATTTAATATTAATATTAA
Homo sapiens chromosome 19 clone CTD-2356P16, complete sequence.
AC008962.9:39696-39710
AAGCCACCACACCCGGCCTATCTTAGCTTT39696AGTATAATGTTAACAGCTCTCCTAAGGGAG
Homo sapiens chromosome 8, clone CTC-386L14, complete sequence.
AC090816.3:66203-66217
GTATTTTTAAATTCATCGATATTTCCACTT66203ATTAAGTTTTATTGTGTCTCTTTTTTCAAA
Homo sapiens chromosome 3 clone RP11-421B21 map 3p, complete sequence.
AC090949.2:117016-117030
ATTGTAATAGCCAGAAATTGGAAACATATA117016TAAGATTATAATATAGTCATATAATAGTCC
Homo sapiens chromosome 5 clone CTD-2105K20, complete sequence.
AC091838.2:60349-60363
CCTGGGTATAATGCACTGATCTGTTGATCT60349GCCATCGACTTTGGAGCTGGAAAGGCCCTC
Homo sapiens BAC clone RP11-340B18 from 4, complete sequence.
AC097502.3:52626-52640
AAAAACGTCTGATTTTGTGTAACACTCCTT52626AAACAGCAATTAACTATTTGCTGATTACAT
Homo sapiens BAC clone RP11-182K3 from 2, complete sequence.
AC104598.4:73478-73492
ATTGCAGCAAAGAAGCACATTTATATTCTA73478AGCATATAATGCAAATTTACTTTGGAACTT
Homo sapiens 3 BAC RP11-474M18 (Roswell Park Cancer Institute Human BAC Library) complete sequence.
AC107025.3:78694-78708
TTGGTTTTGTATATATTAAATAGTTGAAAC78694AAGTTTGTTTTCTAGGCTCTATTGGGATAA
Homo sapiens BAC clone RP11-452J21 from 4, complete sequence.
AC108063.3:105748-105762
AACGAAAGGCGTTTGAGGAAAGCCTGATAA105748ACCATCAACCACACCTTACCATTCCTAGGA
Homo sapiens chromosome 18, clone RP11-784B15, complete sequence.
AC117569.3:88246-88260
ATATTTATATATGTATATATTTCATATTAT88246TACTTGGGAGATTTGTCTCAACAAAAATTA
Homo sapiens neuregulin 1 (NRG1) gene, partial cds, alternatively spliced.
AF491780.1:103463-103477
GTATTTTTAAATTCATCGATATTTCCACTT103463ATTAAGTTTTATTGTGTCTCTTTTTTCAAA
Human DNA sequence from clone RP11-170N11 on chromosome 1.
AL354654.15:105182-105196
CTAATTAATGAATAGTAAGTATATTTTCTC105182TTTCCTCTTACTTTATTGTAAGAATACAAT
Human DNA sequence from clone RP11-173B15 on chromosome 6.
AL360220.12:37485-37499
CTATTTCAATCAACCATCTTGTAATCATAC37485TTACTCATACTATAATAAGTTGCTATTTCT
Human DNA sequence from clone RP11-661D17 on chromosome 13.
AL445604.9:147395-147409
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA147395TCCTGAGGTAACTCACACTGAGGTGACAAC
Pan troglodytes BAC clone CH251-643N11 from chromosome 7, complete sequence.
AC188940.3:129735-129749
TATATTTGTTATAGAATATTATGTTAAATC129735AAAGAGTCATACCTTTTATGGGTGTTAGTT
Pan troglodytes BAC clone CH251-639B17 from chromosome 7, complete sequence.
AC192004.3:189879-189893
GTGGTGCCTGGCCTGAGTCAGCTCAGTAGC189879GGTTCGTTTAACAAATATTGCCTGAGAAGA
Macaca mulatta BAC CH250-327F20 () complete sequence.
AC202850.6:193298-193312
GTGAGCCACCACACCGGCCTATCTTAGCTT193298AGTATAATGTTAACAGCTCTCCTAAGGGAG
Rattus norvegicus Mcs BAC CH230-1A1 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence.
AC091242.12:72597-72611
TGAATGAAAGGTCAGAGTTCAAGGTGTGAT72597AAATATTTACTGAATCTTAAATCTTATCCT
Rattus norvegicus Mcs1 CH230-3I8 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence.
AC094490.9:77809-77823
TGAATGAAAGGTCAGAGTTCAAGGTGTGAT77809AAATATTTACTGAATCTTAAATCTTATCCT
Mus musculus chromosome 3, clone RP23-341B15, complete sequence.
AC102806.18:103943-103957
ATTGCAAACCTTAACTTACAGGGATGTTTA103943TTACTTATTTTTCATTTCTCTGATGTTTAA
Mus musculus chromosome 3, clone RP23-49O22, complete sequence.
AC107701.8:76582-76596
TAGATTCTGCCTCAGAACTTGTAGTTGAAG76582GGTCAACATGCAGCTTGAATCTGGGGCAAC
Mus musculus chromosome 5, clone RP23-330E5, complete sequence.
AC118200.8:51451-51465
TAGAATCAGTGTAAGCCATCCCTACACTTA51451CATGCAATCTTCAGTGTTCATTACTTTGCT
Mus musculus BAC clone RP23-109J14 from 1, complete sequence.
AC125216.3:133794-133808
GAATACTTAATGTACCATTTGGAAACACTG133794TTATTTGCTATTTCCTGCTGTCTTTAAAAA
Rattus norvegicus CH230-12L9 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence.
AC132498.4:110866-110880
CCTCTCCCATTTACATTTAGTTTTAAGTAA110866TTTTGCATTGTTCAGCCCTTTACCTGTATT
Mus musculus BAC clone RP24-159A20 from chromosome 5, complete sequence.
AC152165.2:163547-163561
GTCAACATGTACTTTAAACTTTAGTAATGT163547GATGCTTTTGGCTTGGGGGCATGGATGCTA
Mus musculus 6 BAC RP23-387H1 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence.
AC158660.4:195953-195967
AAAGTACTATCAGTTTCCTAAATATATCCA195953GTTCACTCTTCCATAAACATCTGCTGGTTA
Mouse DNA sequence from clone RP23-307O24 on chromosome 2.
AL831781.8:102647-102661
AGACAAATTAAGACTGTATTGTATCATGGT102647TAAAATTGTTACATATTTCAAAATTTTTTA
Mouse DNA sequence from clone CH29-502J5 on chromosome 6.
CU207317.13:16788-16802
TGAACACATTCTCCCTGTTTGTGTCATCAC16788TAACTGGGCCTTCTGTGTGGATACCATGAT
Pteropus vampyrus clone CH279-375K22, complete sequence.
AC204458.3:16771-16785
CTCACCCAAAGGGTTGGGTAACAGGGAAAT16771TGGGCAAAAGTATTTGGGGAGATGCCCTTT
Cyprinus carpio mRNA for ATP synthase beta-subunit, complete cds.
AB023582.1:889-903
CGTGACCAGGAGGGGCAGGATGTGCTGCTA889TTCCGCTTCACCCAGGCTGGATCAGAGGTG
Chrysemys picta BAC clone CHY3-119H12 from chromosome unknown, complete sequence.
AC239498.2:19046-19060
ATGGAATGAGAATATAGAAAGGAGTAACAC19046AGCTTCTATATGCCTCCATAAGACTTGTTT
Xenopus laevis ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit, mRNA (cDNA clone MGC:53838 IMAGE:5542544), complete cds.
BC046741.1:929-943
AGAGATCAAGAGGGACAAGATGTGTTGCTT929TTCAGGTTCACCCAGGCTGGTTCAGAGGTG
Xenopus laevis engrailed homolog 2, mRNA (cDNA clone MGC:196517 IMAGE:9041424), complete cds.
BC169790.1:556-570
CACCAGCCCCATCACAGGATAACGAACTTC556CTACGGCCGGAGTTCGGGAGGAGGAAAGAA
Xenopus laevis engrailed homolog 2, mRNA (cDNA clone MGC:196519 IMAGE:9041426), complete cds.
BC169792.1:556-570
CACCAGCCCCATCACAGGATAACGAACTTC556CTACGGCCGGAGTTCGGGAGGAGGAAAGAA
Zebrafish DNA sequence from clone DKEYP-95B12 in linkage group 16.
BX323565.10:39334-39348
GTTTGAGATATAGGCCTATGCTTACAATCT39334ATAAGACCATTTAATTCACTGGTAAAATCA
Zebrafish DNA sequence from clone DKEY-84I7 in linkage group 5.
BX465199.9:115149-115163
TTATAAAGTTGATTTATGTGCTTGTCATCT115149ATTAAACCATTAGTTTTCACTGGAAAAATG
Zebrafish DNA sequence from clone CH211-63C23 in linkage group 10.
BX470204.13:1023-1037
GAAGGAGAGAATGCCAACAACTTTCCTCGG1023ACTGAACAACAACAAGTAAGGGTCTTAAAG
Zebrafish DNA sequence from clone CH211-282F6 in linkage group 3.
CR812464.10:100630-100644
GCGTCTGTTGTGGCGAAACTGTTGTCCTGC100630GTATGACCTTGGCTTATTTCGTTTTGAAAC
Zebrafish DNA sequence from clone CH211-237A4 in linkage group 4.
CR812471.13:29589-29603
GCGTCTGTTGCGGCGAAACTGTTGTCCTGC29589GTATGACCTTGGCTCATTTCTTTTTGAAAC
Zebrafish DNA sequence from clone CH73-241F5 in linkage group 2.
CU694255.9:47445-47459
GCGTCTGTTGCGGCGAAACTGTTGTCCTGC47445GTATGACCTTGGCTCATTTCTTTTTGAAAC
Zebrafish DNA sequence from clone CH73-78K15 in linkage group 1.
CU929244.6:32740-32754
CGGAGCGCAGGTTGAGATCTCCTTGCTGGT32740TCCGGCAGAAGCCTAGCTTTTCCCATGTGG
X.laevis mRNA for En-2 (EN2 1.4).
X62973.1:604-618
CACCAGCCCCATCACAGGATAACGAACTTC604CTACGGCCGGAGTTCGGGAGGAGGAAAGAA
Drosophila melanogaster 3L BAC RPCI98-25O1 (Roswell Park Cancer Institute Drosophila BAC library) complete sequence.
AC010066.9:82672-82686
CGCGACGTGGACGGGCAGGATGTGCTGCTC82672TTCCGTTTCACCCAGGCGGGATCGGAGGTG
Daphnia pulex clone JGIAZSN-5K3, complete sequence.
AC167686.2:16544-16558
AAGTCGAAAAAGATTGAGACGAAACATCAT16544TGCCCATAGGGTGTAATAATACGCTACGTT
Trichinella spiralis BAC clone TS195-2H12 from chromosome unknown, complete sequence.
AC189676.2:51234-51248
ACCAACTTTATTCAATATATAATTAGCCAT51234GCCAAGATGAACTTCTATCTGAAGTAGAGA
Drosophila melanogaster chromosome 3L, complete sequence.
AE014296.4:16092264-16092278
CGCGACGTGGACGGGCAGGATGTGCTGCTC16092264TTCCGTTTCACCCAGGCGGGATCGGAGGTG
Eurypelma californicum mRNA for hemocyanin subunit f (hcF gene).
AJ277491.1:1160-1174
AGGGATCCGATCTTCTACAGGTACCATCGA1160TTCCAGGAGTACAAGGCAACTCTTCCATGC
Thelaxes suberi partial atpD gene for ATPase beta subunit.
AJ296761.1:271-285
AGAGATCAAGAAGGTCAAGATGTATTACTT271TTCCGTTTTACTCAAGCTGGTTCTGAAGTA
Panaphis juglandis partial atpD gene for ATPase beta subunit.
AJ296762.1:271-285
AGAGATCAAGAAGGACAGGATGTATTGCTT271TTCCGTTTTGCTCAAGCCTGGTCCGAAGTG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ddbj92/TTCATTGACAACATT
lang : en | db : ddbj92 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
2.574 | 2.567 | search_plus_done; http://172.18.8.76:42313/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
3.805 | 1.231 | search_minus_done; http://172.18.8.76:42313/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=0
3.805 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).