GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 11:28:23, GGGenome : D. grimshawi genome, Agencourt prelim/droGri1 (Aug, 2005)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold_7154:925-939
TTGCGATGTGGCTCGACGGCTCTACCAAAT925TTCATTGACAACATTCGAATGGCTCTTGGCCAAACAAAGTGCATT
scaffold_24992:1870105-1870119
TTGCGATGTGGCTCGACGGCTCTACCAAAT1870105TTCATTGACAACATTCGAATGGCTCTTGGCCAAACAAAGTGCATT
scaffold_24997:2474412-2474426
TTAAAAGTGTTGTTAAATGTTGGATATATT2474412TTCATTGACAACATTGACAAGTTTATTGTAGTTGCCACTGTCCGC
scaffold_25041:2799309-2799323
CCGATAGTTCCTTAAAGAATTCAGCGTTAT2799309TTCATTGACAACATTCAATCAGGTGTCAAAAAGAGTTTTTCCAAC
scaffold_24895:175073-175087
TTAGTCAACTGCCATCAGCGGGCAAAGTTC175073AATGTTGTCAATGAATAATGCTTGATGGGCTTTTCTGTAGGTGGA
scaffold_25029:4930184-4930198
GATATTAAACATTGCTTAATATTGCTTAAT4930184AATGTTGTCAATGAAATGAAAGATCTTTCAAAACCACAACTAGCT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/droGri1/TTCATTGACAACATT
lang : en | db : droGri1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.084 | 0.077 | search_plus_done; http://172.18.8.76:28097/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.093 | 0.010 | search_minus_done; http://172.18.8.76:28097/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=46
0.094 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).