GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-01 11:59:48, GGGenome : D. virilis genome, Agencourt prelim/droVir2 (Aug, 2005)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold_12963:16930099-16930113
CACACACAAAGACCACACCTCATCTAGCCA16930099TTCATTGACAACATTCAGCATTGTAGATAACATTCAGGAAAATGC
scaffold_13246:1722244-1722258
ATGCATTTTTGGCCAACGGCCATTCGAGCA1722244AATGTTGTCAATGAAATTAAATAGCCCTCGAGCCAGCCGAATCGA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/droVir2/TTCATTGACAACATT
lang : en | db : droVir2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.104 | 0.096 | search_plus_done; http://172.18.8.76:28105/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.112 | 0.008 | search_minus_done; http://172.18.8.76:28105/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=49
0.113 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).