GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-08-15 00:02:30, GGGenome : D. yakuba genome, WUGSC 7.1/droYak2 (Nov, 2005)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr3L:18657322-18657336
CGCGACGTGGACGGGCAGGATGTGCTGCTC18657322TTCATTGACAACATTTTCCGTTTCACGCAGGCGGGATCGGAAGTG
chr3L_random:2648390-2648404
CGCGACGTGGACGGGCAGGATGTGCTGCTC2648390TTCATTGACAACATTTTCCGTTTCACCCAGGCGGGATCGGAAGTG
chr3R:24637540-24637554
CGCGACCCAGTCTTCTACAAGTGGCACGCG24637540TTCATTGACAACATTTTCCAGGAGCACAAGGGGCGACTTCCGGCC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/droYak2/TTCATTGACAACATT
lang : en | db : droYak2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.078 | 0.071 | search_plus_done; http://172.18.8.76:28106/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.082 | 0.004 | search_minus_done; http://172.18.8.76:28106/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=47
0.082 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).