GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-04-20 10:27:40, GGGenome : Drosophila willistoni genome, dwil_caf1 (Jul, 2008)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scf2_1100000007178 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000007178:1:1171:1
position: 1063-1077
GTTATTCGAATTCAATGCAATAATATCAAA1063AATGTTGTCAATGAAATCAATTTTTTTTTTTTTTTTTTTTAACGT
scf2_1100000008390 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000008390:1:1382:1
position: 297-311
GTTATTCGAATTCAATGCAATAATATCAAC297AATGTTGTCAATGAAATTAATAACTTTAAAAAACGACAACAGGTA
scf2_1100000000813 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000000813:1:2121:1
position: 717-731
GTTATTCGAATTCAATGCAATAATATTAAA717AATGTTGTCAATGAAATTAATAACTTCAAAAACGACAACAGGTAA
scf2_1100000002037 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000002037:1:4398:1
position: 2340-2354
GTTATTCGAATTCAATGCAATAATATTAAA2340AATGTTGTCAATGAAATTAATAACTTCAAAAACGACAACAGGTAA
scf2_1100000001227 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000001227:1:4776:1
position: 2462-2476
GTTATTCGAATTCAATGCAATAATATTAAA2462AATGTTGTCAATGAAATTAATAACTTCAAAAACGACAACAGGTAA
scf2_1100000000678 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000000678:1:5605:1
position: 25-39
CGAATTCAATGCAATAATATTAAA25AATGTTGTCAATGAAATTAATAACTTTAAAAAATGACAACAGGTA
scf2_1100000004392 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000004392:1:7396:1
position: 1700-1714
GTTATTCGAATTCAATGCAATAATATCAAA1700AATGTTGTCAATGAAATTAATAACTTTAAAAAACGACAACAGGTA
scf2_1100000000620 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000000620:1:7599:1
position: 313-327
GTTATTCGAATTCAATGCAATAATATCAAA313AATGTTGTCAATGAAATTAATAACTTCAAAAACGACAACAGGTAA
scf2_1100000004488 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000004488:1:14715:1
position: 13752-13766
GTTATTCGAATTCAATGCAATAATATCAAA13752AATGTTGTCAATGAAATTAATAACTTCAAAAACGACAACAGGTAA
scf2_1100000004897 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000004897:1:39961:1
position: 28790-28804
GTTATTCAAATTCAATGCAATAATATCAAA28790AATGTTGTCAATGAAATTAATAACTTCAAAAACGACAAAAGGTAA
scf2_1100000004542 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000004542:1:176419:1
position: 116536-116550
GTTATTCGAATTCAATGCAATAATATCAAA116536AATGTTGTCAATGAAATTAATAAGATATGCCAGATGAAGATATGC
scf2_1100000004887 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000004887:1:623120:1
position: 97293-97307
GTTATTCGAATTCAATGCAATAATATCAAA97293AATGTTGTCAATGAAATTAATAACTTAAAAAACGACAACAGGTAA
scf2_1100000004953 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000004953:1:1556085:1
position: 470885-470899
GTTATTCGAATTCAATGCAATAATATCAAA470885AATGTTGTCAATGAAATTAATAACGTCAAAAACGACAACAGGTAA
scf2_1100000004909 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000004909:1:12416693:1
position: 515990-516004
GTTATTCGAATTCAATGCAATAATATCAAA515990AATGTTGTCAATGAAATTAATAACGTCAAAAACGACAACAGGTAA
scf2_1100000004521 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000004521:1:12563649:1
position: 10267449-10267463
TGGCCCACAACCAAAAATACCAAATAACTG10267449AATGTTGTCAATGAAAATTTCAAATGAAAATAGTGTGAAAGCAGC
scf2_1100000009278 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000009278:1:1072:1
position: 996-1010
TTACCTGTTGTCGTTTTTGAAGTTATTAAT996TTCATTGACAACATTTTTAATATTATTGCATTGAATTCGAATAAC
scf2_1100000010097 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000010097:1:1100:1
position: 196-210
TACCTGTTGTCGTTTTTTAAAGTTATTAAT196TTCATTGACAACATTTTTAATATTATTGCATTGAATTCGAATAAC
scf2_1100000005111 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000005111:1:1155:1
position: 385-399
TTACCTGTTGTCGTTTTTGAAGTTATTAAT385TTCATTGACAACATTTTTAATATTATTGCATTGAATTCGAATAAC
scf2_1100000009966 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000009966:1:1200:1
position: 763-777
TTACCTGTTGTCGTTTTTGAAGTTATTAAT763TTCATTGACAACATTTTTAATATTATTGCATTGAATTCGAATAAC
scf2_1100000010020 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000010020:1:1260:1
position: 463-477
TTACCTGTTGTCGTTTTTGAAGTTATTAAT463TTCATTGACAACATTTTTAATATTATTGCATTGAATTCGAATAAC
scf2_1100000013720 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000013720:1:1291:1
position: 482-496
TACCTGTTGACGTTTTTTAAAGTTATTAAT482TTCATTGACAACATTTTTAATATTATTGCATTAAATTCGAATAAC
scf2_1100000007279 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000007279:1:1298:1
position: 1121-1135
TACCTGTTGTCGTTTTTTAAAGTTATTAAT1121TTCATTGACAACATTTTTAATATTATTGCATTGAATTCGAATAAC
scf2_1100000013461 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000013461:1:1430:1
position: 121-135
TACCTGTTGTCGTTTTTTAAAGTTATTAAT121TTCATTGACAACATTTTTGATATTATTGCATTGAATTCGAATAAC
scf2_1100000003060 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000003060:1:1663:1
position: 1539-1553
AACGTTAAAAAAAAAAAAAAAAAAATTGAT1539TTCATTGACAACATTTTTGATATTATTGAATTGAATTCGAATAAC
scf2_1100000004109 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000004109:1:1746:1
position: 84-98
ATTACCTGTTGTCGTTTTGAAGTTATTAAT84TTCATTGACAACATTTTTGATATTATTGCATTGAATGGAATAACA
scf2_1100000001022 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000001022:1:1898:1
position: 1127-1141
TTACCTGTTGTCGTTTTTGAAGTTATTAAT1127TTCATTGACAACATTTTTGATATTATTGCATTGAATTCGAATAAC
scf2_1100000000641 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000000641:1:3695:1
position: 1675-1689
TTACCTGTTGTCGTTTTTGAAGTTATTAAT1675TTCATTGACAACATTTTTGATATTATTGCATTGAATTCGAATAAC
scf2_1100000000317 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000000317:1:4186:1
position: 3995-4009
TTACCTGTTGTCGTTTTTGAAGTTATTAAT3995TTCATTGACAACATTTTTGATATTATTGCATTGAATTCGAATAAC
scf2_1100000003404 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000003404:1:4740:1
position: 2818-2832
TACCTGTTGTCGTTTTTTAAAGTTATTAAT2818TTCATTGACAACATTGTTGATATTATTGCATTGAATTCGAATAAC
scf2_1100000001081 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000001081:1:4794:1
position: 778-792
TTACCTGTTGTCGTTTTTGAAGTTATTAAT778TTCATTGACAACATTTTTAATATTATTGCATTGAATTCGAATAAC
scf2_1100000000537 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000000537:1:4809:1
position: 577-591
GTTGCAATTACGTTTTTTAAAGTTATTAAT577TTCATTGACAACATTTTTGATATTATTGCATCGAATTCGAATAAC
scf2_1100000004454 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000004454:1:5141:1
position: 5097-5111
TTTCCAGTGGTTGTTCTTGATGTTATGATT5097TTCATTGACAACATTTTTGAAATTATCGCGTTGAATTCAAAAAGC
scf2_1100000002563 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000002563:1:5189:1
position: 1668-1682
TACCTGTTGTCGTTTTTTAAAGTTATTAAT1668TTCATTGACAACATTTTTGATATTATTGCATTGAATTCGAATAAC
scf2_1100000001023 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000001023:1:5473:1
position: 611-625
TTACCTGTTGTCGTTTTTGAAGTTATTAAT611TTCATTGACAACATTTTTGATATTATTGCATTGAATTCGAATAAC
scf2_1100000004452 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000004452:1:5973:1
position: 700-714
TTACCTGTTGTCGTTTTTGAAGTTATTAAT700TTCATTGACAACATTTTTGATATTATTGCATTGAATTCGAATAAC
scf2_1100000003426 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000003426:1:6139:1
position: 765-779
TTACCTGTTGTCGTTTTTGAAGTTATTAAT765TTCATTGACAACATTTGTGATATTATTGCATTGAATTCGAATAAC
scf2_1100000000077 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000000077:1:6556:1
position: 6279-6293
TTACCTGTTGTCGTTTTTGAAGTTATTAAT6279TTCATTGACAACATTTTTGATATTATTGCATTGAATTCGAATAAC
scf2_1100000004391 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000004391:1:6699:1
position: 3220-3234
TTACCTGTTGTCGTTTTTGAAGTTATTAAT3220TTCATTGACAACATTTTTGATATTATTGCATTGAATTCGAATAAC
scf2_1100000004363 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000004363:1:7592:1
position: 3975-3989
TTACCTGTTGTCGTTTTTGAAGTTATTAAT3975TTCATTGACAACATTTTTGATATTATTGCATTGAATTCGAATAAC
scf2_1100000004904 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000004904:1:77927:1
position: 21907-21921
TTACCTGTTGTCGTTTTTGAAGTTATTAAT21907TTCATTGACAACATTTTTGATATTATTGCATTGAATTCGAATAAC
scf2_1100000004904 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000004904:1:77927:1
position: 41663-41677
TTACCTGTTGTAGTTTTTGAAGTTATTAAT41663TTCATTGACAACATTTTTAATATTATTGCATTGAATTCGAATAAC
scf2_1100000004904 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000004904:1:77927:1
position: 64231-64245
TACCTGTTGTCGTTTTTTAAAGTTATTAAT64231TTCATTGACAACATTTTTAATATTATTGCATTGAATTCGAATAAC
scf2_1100000004953 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000004953:1:1556085:1
position: 100849-100863
TTTCCAGTGGTTGTTTTTGAAGTTGTGACT100849TTCATTGACAACATTTTCGACATTATTGCGTTGAATTCAAAAAGC
scf2_1100000004953 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000004953:1:1556085:1
position: 1130817-1130831
TTTCCAGTGGTTGTTTTTGAAGTTGTGACT1130817TTCATTGACAACATTTTCGACATTATTGCGTTGAATTTAAATAGC
scf2_1100000004958 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000004958:1:2682060:1
position: 319238-319252
TTTCCAGTGGTTGTTCTTGATGTTATGATT319238TTCATTGACAACATTTTTGAAATTATCGCGTTGAATTCAAAAAGC
scf2_1100000004514 dna:supercontig supercontig:GCA_000005925.1:scf2_1100000004514:1:3904529:1
position: 2506273-2506287
TTAGAAGTGGATAACTGACCTTTACTTGGT2506273TTCATTGACAACATTTATTAAGATATCAATTTTCTTGTGACTTTC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/dwil_caf1/AATGTTGTCAATGAA
lang : en | db : dwil_caf1 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.077 | 0.070 | search_plus_done; http://172.18.8.76:28144/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.090 | 0.013 | search_minus_done; http://172.18.8.76:28144/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=35
0.108 | 0.017 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).