GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-02-24 05:52:49, GGGenome : Tenrec genome, Broad/echTel2 (Nov, 2012)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

JH980294:32668166-32668180
GAAGATGGTACTGAAGGAAGATGTCCAAGT32668166TTCATTGACAACATTGGTCCAAAGCAAGGCTCCAGAAGCTGATGC
JH980300:78759541-78759555
TTTCCATTTAATCTGGATCTCTGACTTCTT78759541TTCATTGACAACATTTCTATATTTACTTTCAGTTATATGTCCCAA
JH980303:30784387-30784401
GGCGGCCACGTGTTAAAGAAAAAAACCAAA30784387TTCATTGACAACATTCGTGCTGCTGTAGGACTTACACTGGCCGGC
JH980309:309971-309985
CTGACTAGTAAACTAAAAGTGTGTTACTAA309971TTCATTGACAACATTTTCATAGAAAGTCGTATTTGAACGGTGGAA
JH980310:35335734-35335748
TATATATATATTTTTTTTACGTCATATATT35335734TTCATTGACAACATTGGACAGACAAAATGAAGCGAGGTGTTGTAC
JH980311:9701502-9701516
ATGAGAAATCTGAAAAAGCAAACAAAGAAT9701502TTCATTGACAACATTGAAGATGGTAAAATACCCAGGAGTGCATCT
JH980312:42174023-42174037
GAATGCTTGTTAAAGTTCATAGTTCATCCA42174023TTCATTGACAACATTTTCAGTTAATGAATACCTTCTTTTCCATGC
JH980324:13046991-13047005
ATTTGAAGGTCAGCTGATTAACAACTTTAA13046991TTCATTGACAACATTAATTTCCTTTTGCCATTTAACCTAGCGCAG
JH980342:9346089-9346103
GGTACTGATTGCTGATCCTAGTAGAACAAA9346089TTCATTGACAACATTATTTTTATCTACATCTAACGTGATACAGTT
JH980304:40192421-40192435
TGCCTGTTTTCATATGCATATGTAACAGGG40192421AATGTTGTCAATGAAAACACAAAAGTATTTGGAGAGCAGCGTAGT
JH980305:57745780-57745794
TCTCCAGCTCGCCAGACTTCCTCCTGTCGA57745780AATGTTGTCAATGAACAAATACGGTCAACGGACACAGACCTACTA
JH980308:27841688-27841702
CTATATGTATGAACTAGGAAAAGTATTCAC27841688AATGTTGTCAATGAAAATGTGTAGGTAGCTGATACCACATAATTG
JH980324:1075324-1075338
GTTATTCTTGAGGATAAATTGAAGCAATTA1075324AATGTTGTCAATGAAAGAATAATCACCAAGGTGATATACACGGTC
JH980325:14740709-14740723
ATAGCATCTGTAACACATTTAATTATTTAA14740709AATGTTGTCAATGAAACTTCTGATGATTGTATAGTATATCATTTG
JH980351:8770076-8770090
AAGGCACTACTCCATTTTCCCCTAACATGT8770076AATGTTGTCAATGAAAAGTCCATATTAATTTGACTTCTTGACAAT
JH980376:5678206-5678220
CCAACTCATGGTAATCCCAGGTGTATTCAT5678206AATGTTGTCAATGAAAGTGGATTGCCAGGCATTTCTTCAAAGGTG
JH980396:123865-123879
TAAAATATTTTAAAAGGATTAGAATCATAA123865AATGTTGTCAATGAAAGTTATAATAATAGTATCTATTTATTTGTC
JH980458:827092-827106
TTAATCAATTCCTAGAGCCTGTTTTTGGCT827092AATGTTGTCAATGAAATTTGATTTTCATCCTTCAGTACCATTGAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/echTel2/TTCATTGACAACATT
lang : en | db : echTel2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.083 | 0.074 | search_plus_done; http://172.18.8.77:28065/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.092 | 0.009 | search_minus_done; http://172.18.8.77:28065/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=41
0.094 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).