GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-06-17 05:59:41, GGGenome : Aegilops tauschii genome, ASM34733v1 (Dec, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Scaffold179330 dna:supercontig supercontig:GCA_000347335.1:Scaffold179330:1:235:1
position: 73-87
ATGTTCTTCTGGTGTCCTTGAATATACCAG73AATGTTGTCAATGAACACCACAACAAATTTGTCCATGAATTTCAT
Scaffold94266 dna:supercontig supercontig:GCA_000347335.1:Scaffold94266:1:16541:1
position: 7657-7671
ATGAACAAGTTTGTGTTGGGGGAAGGCAAG7657AATGTTGTCAATGAAAACACAGTCATCGAGGGGCAAGGATGGTAT
Scaffold186768 dna:supercontig supercontig:GCA_000347335.1:Scaffold186768:1:23378:1
position: 8874-8888
TAGTACAAAATACTCAGCCTTTCTGCGGCA8874AATGTTGTCAATGAATAAACGAAGAGAATAGACAAGATTCCAGAC
Scaffold6481 dna:supercontig supercontig:GCA_000347335.1:Scaffold6481:1:61797:1
position: 40938-40952
CCGCCTTGGTGCACTCGACGCGGCGTGGTC40938AATGTTGTCAATGAACGACTTCCATCGGAAGAGTACTGTACGTGG
Scaffold40041 dna:supercontig supercontig:GCA_000347335.1:Scaffold40041:1:82371:1
position: 17244-17258
AACATCCGTGAAGAGACGCTTTCAGTTTTG17244AATGTTGTCAATGAAAAGATGTATAATAAAATGGGTGATCAGTTC
Scaffold76296 dna:supercontig supercontig:GCA_000347335.1:Scaffold76296:1:82425:1
position: 33692-33706
TATCATTGTTCAAACCGACTCATCGGAAGC33692AATGTTGTCAATGAAGGGGGACAGTCTTTGGTTTTCTACTTATGA
Scaffold73785 dna:supercontig supercontig:GCA_000347335.1:Scaffold73785:1:33658:1
position: 15354-15368
GAAACATGGTCATCATATGTTACGACATTT15354TTCATTGACAACATTGACATGTGAGTTCATTTTTAAGTTAATGGA
Scaffold48936 dna:supercontig supercontig:GCA_000347335.1:Scaffold48936:1:34801:1
position: 11230-11244
AAAGTAGCCCGTTGGTCTGCCATGTATTAG11230TTCATTGACAACATTCTGTACAGAAAAAGGCCGAACGGTGTGAAA
Scaffold35412 dna:supercontig supercontig:GCA_000347335.1:Scaffold35412:1:49007:1
position: 24359-24373
ATTATCAAACATTGATGAAGGCATTTTGGG24359TTCATTGACAACATTTGAATTTGACCCTAGTTGAGTTCATTTGGT
Scaffold35412 dna:supercontig supercontig:GCA_000347335.1:Scaffold35412:1:49007:1
position: 32618-32632
ATTATCAAACATTGATGAAGGCATTTTGGG32618TTCATTGACAACATTTGAATTTGACCCTAGTTGAGTTCATTTGGT
Scaffold26145 dna:supercontig supercontig:GCA_000347335.1:Scaffold26145:1:55800:1
position: 54942-54956
ATGAAATTCATGGACAAATTTGTGGTGGTA54942TTCATTGACAACATTCTGGTTTACTCGAGGACACCAGAAGAGCAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/en/ASM34733v1/AATGTTGTCAATGAA
lang : en | db : ASM34733v1 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.071 | search_plus_done; http://172.18.8.75:28166/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.087 | 0.008 | search_minus_done; http://172.18.8.75:28166/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=44
0.090 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).