GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2025-10-29 04:43:59, GGGenome : Cucumis sativus (Gy14) genome, v1

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold02633
position: 503627-503641
TTTTGGCATATTTACCTGGGTAAAGCGGAA503627AATGTTGTCAATGAAGAGAAGCACATCCTGTCCTTCAGCATCACG
scaffold00934
position: 15420-15434
CAAATAATACCAAAATGTAGAAGATTAAAC15420TTCATTGACAACATTTACAAATCATCTCTTCTAGTTTTTAAACAT
scaffold01543
position: 951329-951343
AGTTCTATTCTTTTCAATAGCATTTATTTC951329TTCATTGACAACATTCTTCCATCCAGGACACTCTAAAGTAGTGTA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : https://gggenome.dbcls.jp/en/Csativus_Gy14/AATGTTGTCAATGAA
lang : en | db : Csativus_Gy14 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.009 | 0.009 | search_start;
0.078 | 0.069 | search_plus_done; http://172.18.8.72:28212/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.082 | 0.004 | search_minus_done; http://172.18.8.72:28212/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=49
0.084 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).