GGGenome Help | Japanese


Max number of mismatches/gaps: (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2018-09-24 23:58:36, GGGenome : Marchantia polymorpha genome, JGI 3.1

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold_1
position: 5373622-5373636
CAAAAAACTATGAATAATTCCATTGATTAT5373622TTCATTGACAACATTGGAGTGATTAGATCACTCAATATAGAATTC
scaffold_34
position: 895867-895881
CGAATCGGAGTCACATGCTATCAATGCAAT895867TTCATTGACAACATTGTCAGATTTGCAAGCTTGGAAAGTGGAAGG
scaffold_4
position: 2504290-2504304
GAAAATGCGTTAGATAATCTTGTTGAAACT2504290TTCATTGACAACATTGGAGTGATTGGACAATTCAATACAGAATCA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/en/Mpolymorpha_3.1/TTCATTGACAACATT
lang : en | db : Mpolymorpha_3.1 | k : 0 | strand : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.006 | 0.006 | search_start;
0.088 | 0.082 | search_plus_done; http://172.18.8.72:43583/match?q=TTCATTGACAACATT&k=0&offset=0&limit=50
0.108 | 0.020 | search_minus_done; http://172.18.8.72:43583/match?q=AATGTTGTCAATGAA&k=0&offset=0&limit=47
0.108 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).