GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2025-10-27 16:11:02, GGGenome : Pediculus humanus genome, PhumU2 (Nov, 2008)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

DS235371 dna:supercontig supercontig:PhumU2:DS235371:1:284323:1
position: 78574-78588
CACGTTCGCTCTTTTTTCTCACTCCCCCCC78574TTCATTGACAACATTCGCGCACGAAACGTTGTTAACTAATCCGTG
DS235283 dna:supercontig supercontig:PhumU2:DS235283:1:462513:1
position: 341788-341802
TTTTTTTTTTCACAACGAAAATTATCCATT341788TTCATTGACAACATTTGAAAATCAGGATCAGGGTCTTATCCTTAA
DS234996 dna:supercontig supercontig:PhumU2:DS234996:1:474860:1
position: 111643-111657
AAATATTATAGGATCTAATTCTTCTCCTTT111643TTCATTGACAACATTTGTAAAAGCCGTTGCCCACGGTTGTCCTAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : https://gggenome.dbcls.jp/en/PhumU2/AATGTTGTCAATGAA
lang : en | db : PhumU2 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.009 | 0.009 | search_start;
0.083 | 0.074 | search_plus_done; http://172.18.8.76:28156/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.086 | 0.003 | search_minus_done; http://172.18.8.76:28156/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.089 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).