GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2025-04-17 04:45:18, GGGenome : Tetrahymena borealis genome (Oct, 2012)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

supercont1.26 of Tetrahymena borealis
position: 214559-214573
TTAAGATATGGATTGATCAGATTACCTATG214559TTCATTGACAACATTTGGGGTAATGCTGAAGCTATTAAATCTCAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:


GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).