GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2025-10-26 22:37:54, GGGenome : Ramazzottius variornatus (YOKOZUNA-1) genome (Sep, 2016)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

BDGG01000001.1 Ramazzottius varieornatus DNA, contig: Scaffold001, strain: YOKOZUNA-1.
position: 4274547-4274561
CGTGATCAAGAGGGTCAGGATGTGTTGCTC4274547TTCATTGACAACATTTTCCGCTTCACCCAAGCTGGTTCGGAGGTA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : https://gggenome.dbcls.jp/en/YOKOZUNA-1/AATGTTGTCAATGAA
lang : en | db : YOKOZUNA-1 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.009 | 0.009 | search_start;
0.080 | 0.071 | search_plus_done; http://172.18.8.72:28267/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.084 | 0.004 | search_minus_done; http://172.18.8.72:28267/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.084 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).