GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2025-10-25 08:16:15, GGGenome : Marmoset spliced RNA, TRaC 21.01 protein coding on calJacRKC1912, D3G 21.01 (Jan, 2021)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

TRaC2101L1e5a5;ENSCJAG00000014861|RBMS1|chr6:92541779:92686106:-|spliced::chr6:92541779-92686106(-)
position: 1297-1311
AAGTTCCAAAGTAAATTTGCATTATATGCT1297AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
TRaC2101L1e5a6;ENSCJAG00000014861|RBMS1|chr6:92548603:92606985:-|spliced::chr6:92548603-92606985(-)
position: 1132-1146
AAGTTCCAAAGTAAATTTGCATTATATGCT1132AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : https://gggenome.dbcls.jp/en/calJacRKC1912_Trac2101ProtCoding_spliced_d3g2101/TTCATTGACAACATT
lang : en | db : calJacRKC1912_Trac2101ProtCoding_spliced_d3g2101 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.009 | 0.009 | search_start;
0.080 | 0.071 | search_plus_done; http://172.18.8.75:28855/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.083 | 0.003 | search_minus_done; http://172.18.8.75:28855/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.085 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).