GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-05-19 08:17:14, GGGenome : Elephant shark genome, Callorhinchus_milii-6.1.3/calMil1 (Dec, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

KI635857:5289376-5289390
ATTGACTGATTTTTATCCGAAGAATCTCAG5289376TTCATTGACAACATTTTTTCATTGCCCTACAACTGCTGCCTTTCC
KI635882:2234941-2234955
AAAAGTGTAAGAGAACTTTTTGCATTTTGT2234941TTCATTGACAACATTTTTGCCTAAGAGGAAATGGTTCTGTTGCCC
KI635900:4486157-4486171
CTCAAACCATTCAGATCCGGTCTTAAGTGT4486157TTCATTGACAACATTGGAACAAAACCTTCATTTCAAAGCTGGCTG
KI636071:376475-376489
AACTGAACATCCGAAACCTCCACATGGTTA376475TTCATTGACAACATTCTGTTCCCGAGTGTGCCATCTTGGAGTCAG
KI636423:6933-6947
CATTTCCGTTTATTCTAATTGTTAGATTAT6933TTCATTGACAACATTCGCCAGTGATGTATGTCTCTGTGTGACTGA
KI635857:16229534-16229548
CCGGGGGTAATAATCCCTTAAAAAAATGAT16229534AATGTTGTCAATGAATCCACGACTGTTTGTGGGACGCTGCTGTGC
KI635916:676130-676144
TCGGAAGAGCTCCTCGGCTCACTTTTAATG676130AATGTTGTCAATGAAAAGAATTTTGTTATCGATCGGAACCAAGAG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/en/calMil1/TTCATTGACAACATT
lang : en | db : calMil1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.080 | 0.072 | search_plus_done; http://172.18.8.76:28074/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.084 | 0.005 | search_minus_done; http://172.18.8.76:28074/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=45
0.085 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).