GGGenome | Results

2025-04-11 07:26:00, GGGenome : DDBJ release 134.0 (Mar, 2024)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and in~~dels~~ are marked in red.

EG-E11_001_G04 embsomSSHE1, Early somatic embryos (SSH) BAP/no BAP Elaeis guineensis cDNA clone EG-E11_001_G04, mRNA sequence.
JK668571.1:449-468

CAGTCAACATGAAGTGGAAGCAAGTGGTGA449ATCAGGGAGACACATCTCAGTTGATTGCCATGTA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Tab-delimited text: Open in new window | Download
You can copy-paste the result into spreadsheet softwares (e.g. Excel) or text editors.
CSV format: Open in new window | Download
You can open CSV files using spreadsheet softwares (e.g. Excel) or text editors.
BED format: Link | Download
GFF format: Link | Download
JSON format: Link | Download

Debug Info:

0.009 | 0.009 | search_start;
0.099 | 0.090 | search_plus_done; http://172.18.8.135:50400/match?q=CTGAGATGTGTCTCCCTGAT&k=0&no_gap=0&offset=0&limit=50
0.222 | 0.123 | search_minus_done; http://172.18.8.135:50400/match?q=ATCAGGGAGACACATCTCAG&k=0&no_gap=0&offset=0&limit=50
0.223 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).