GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-06-17 05:47:52, GGGenome : Crab-eating macaque genome, Macaca_fascicularis_5.0/macFas5 (Jun, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr5:148104515-148104529
CAGAATATATTATCGCTTTGAACACAGATT148104515TTCATTGACAACATTTTGTGGGCATCCATTTAATATTAATATTAA
chr5:165086432-165086446
TAAAACCTCTGATTTTGTGTAACACTCCTT165086432TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGACTACAT
chr5:180823962-180823976
TTTGGACCCCCAGATCAGTCTTCATATTCT180823962TTCATTGACAACATTCATGAAGTTCTGCAGAAATTAGATAGAATT
chr5:185708646-185708660
GCCTGAGCCACCATGCCCAGCTTGCTATTC185708646TTCATTGACAACATTCACTTAAACAAACATCCATAAAATTAAGTC
chr16:14308050-14308064
GCCTCTGGGCCTATATTAGATGGGCCATGC14308050TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
chr17:49623721-49623735
TGTTCAAAGTTTTCCCCTCCAATGTATCTT49623721TTCATTGACAACATTCGGATTTATCACATCAATCAGTCAATAAAT
chr17:66800600-66800614
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA66800600TTCATTGACAACATTGCCTGAGGTAACTCACACTGAGGTGACAAC
chr19:41605405-41605419
GTGAGCCACCATGCTGGCCTATCTTAGCTT41605405TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAA
chr2:112525772-112525786
GCCTGTTTTTCATATGCATATGTAATAGGG112525772AATGTTGTCAATGAAAACACAATAGTATTTGGAGTGCAGCATAGT
chr6:9837729-9837743
GAGGGCCTTTCCAGCTCCAAGGTCAATGGC9837729AATGTTGTCAATGAAAGATCAGCAGGTCAGTGCCTTATACCCAGA
chr11:78340619-78340633
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA78340619AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
chr14:43025544-43025558
GTTTGCTCTATTCACTGTCCTCAACGCTAG43025544AATGTTGTCAATGAACAAGACATATCTATGTTCCTGGAAACTCAA
chr19:41387425-41387439
ACTCCCTTAGGAGAGCTGTAACATTATACT41387425AATGTTGTCAATGAAAAGCTAAGACAGGCCAGGGGTGGTGGCTCA
chr19:41444775-41444789
CTCCCTTAGGAGAGCCGTTAACATTATACT41444775AATGTTGTCAATGAAAAAGCTAAGATAGGCAGGGCGTGGTGGCTC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/en/macFas5/TTCATTGACAACATT
lang : en | db : macFas5 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.080 | 0.072 | search_plus_done; http://172.18.8.78:28758/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.085 | 0.005 | search_minus_done; http://172.18.8.78:28758/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=42
0.087 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).