GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 11:01:28, GGGenome : Horse genome, Broad/equCab2 (Sep, 2007)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr1:117266503-117266517
ATTTATCCTTTAATTGCAGGTTTTCAAATT117266503TTCATTGACAACATTTTTATTTCTAAGATTTCTAATTGGTTCATT
chr1:177999247-177999261
TTGCCTGTCCACAAAAGCTGTGTAGACTTT177999247TTCATTGACAACATTTGGCAACTATTATTAATCTAAACAACGCTA
chr15:14838521-14838535
TGCTCTCTCTTAAAAAGCCTGATTTTTGCT14838521TTCATTGACAACATTCTAATGACTGTTCTCCCTCATATACGAAAG
chr16:53522689-53522703
TGGCTTATACAAAGTTTCGAACTTTTAAAT53522689TTCATTGACAACATTTAAAAATTAGACAATTCATATTTCTGACTT
chr21:43546230-43546244
CAAGTCTAGTTAACATCCTTTATTTATTTA43546230TTCATTGACAACATTCAACCAACATTTACTGAGCCATTAGGCACC
chr2:72853595-72853609
TGAACTGTAGTGCTGTTTGGCTATGAGTTC72853595AATGTTGTCAATGAAAAATATGTTTTAAACTGTCTTTGAACAGAA
chr2:84251160-84251174
TTAATATTAATATTAAATGGATGCCCACAG84251160AATGTTGTCAATGAAAATCTGTGTTTAAAGCGATAATATATTCTA
chr14:72434675-72434689
CGGGGTAAAGTTGAAATTTAGTAAACATTT72434675AATGTTGTCAATGAAATAATTTCCTTAAACTCTGACCTTTGTTTC
chr20:32466916-32466930
CACATCTTCCTCATCCATCCCAATCAACAT32466916AATGTTGTCAATGAAATGAACTAATGTGATATTTTATAGGATGTC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/equCab2/TTCATTGACAACATT
lang : en | db : equCab2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.081 | 0.074 | search_plus_done; http://172.18.8.78:28038/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.086 | 0.005 | search_minus_done; http://172.18.8.78:28038/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=45
0.087 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).