GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-11-29 11:45:01, GGGenome : Hedgehog genome, EriEur2.0/eriEur2 (May, 2012)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

JH835341:1906322-1906336
CCTGTCACAGATTCTATATTCTGCTCATTG1906322TTCATTGACAACATTTTGGCAACCAGGGTGAGGGAAGGTTTGTCT
JH835401:2258974-2258988
TCCCTAAGAAATTTCTGGAAGGGCTCACCG2258974TTCATTGACAACATTTGCCCAGGAAAGGGGGCCAAGGCTGGGTGT
JH835518:1896128-1896142
ATCATACGGGTGAAGCTGGCCAGCTGCGGA1896128TTCATTGACAACATTGTTCTGGCCCGGAAGTTCTTCACGCTCTAC
JH835740:985842-985856
TCTGGATTGCTAAAGATACCTCCCTCTATA985842TTCATTGACAACATTAATAATATCTCATGAACATCTTCTATTTAA
JH835760:705738-705752
AACTCCCCCACTGATACTTTTTAATATATA705738TTCATTGACAACATTTTCAAAAGATTTACTTGATAGAGACTGAAA
JH836029:101438-101452
CTCTCTGTACCTTTCTCTGTATATCTACCT101438TTCATTGACAACATTGGAAACAGAGTTGGCAGTCAGCTGAGGTAA
JH835304:3674957-3674971
TTAATATTAATATTAAATGGATGCCCACAG3674957AATGTTGTCAATGAAAATCTGTGTTTTAAGCGATAATATATTCTA
JH835342:4986515-4986529
CTTCCTAGCACGCAGAACTGAGGAAAATCA4986515AATGTTGTCAATGAATGGAATAATAAGAAGAGTGTTTTGAAACAA
JH835423:2566087-2566101
AATTGATCAGATCACTCAGCAACAACAAGA2566087AATGTTGTCAATGAAAGTCTAGAAAAATAATGTTAACAATTTCCA
JH835434:575422-575436
AGAGTTAGGTCCTTGAATAAGATTTCATAT575422AATGTTGTCAATGAAAAAAAAAAAAGGAATCTTAGCCATGCTGAA
JH835604:763060-763074
GAACAGTGGAAACGTGCTATGGATTATTTA763060AATGTTGTCAATGAACTCAACTACATGACTCAGATTGTTATCATG
JH835682:102696-102710
ACACATACGTACATACATATTTGCTCAGTG102696AATGTTGTCAATGAATGAGCATCTTCATTTTGTGTAAGAAGATTC
JH835689:527283-527297
TACAGGTCATGTGCTATTGCTCAGAGACTT527283AATGTTGTCAATGAAGAGGCATTTAGCTCAGATGAAAACCTGTTG
JH835812:602063-602077
TTTTAGCTTGATATATATAAATATAATGTT602063AATGTTGTCAATGAAAAATTAATTGTACAAAGAAGTGTAAGTTTA
JH836152:432656-432670
TATTTAATTGATATTTACAATTCTGCTCTT432656AATGTTGTCAATGAAGAGTAAATGCATTAAAATCTCTTTTATTGC
JH836480:286022-286036
TGTCACTTTCTCTTTATGAGACAAAGTATC286022AATGTTGTCAATGAAGTAAATGCAATTTTCCTCACTTCCAATCAC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/eriEur2/TTCATTGACAACATT
lang : en | db : eriEur2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.137 | 0.129 | search_plus_done; http://172.18.8.78:28037/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.147 | 0.010 | search_minus_done; http://172.18.8.78:28037/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=44
0.149 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).