GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-08-14 23:16:46, GGGenome : Cat genome, ICGSC Felis_catus_8.0/felCat8 (Nov, 2014)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chrB2:67522330-67522344
GTTGGGGCCAGAGTTCCATCCAGAATTAAG67522330TTCATTGACAACATTCCCCTCACCACTCACTCTTTCCCAGACTTT
chrA1:164231825-164231839
GAACAGTGGAAACGGGCTATGGATTACTTA164231825AATGTTGTCAATGAACTCAATTATATGACTCAGATTGTTATCATG
chrA2:25401672-25401686
GCCTGTTTTTCATATGCATATGTAATAGTG25401672AATGTTGTCAATGAAAACACAATAGTATTTGGAGTGCAGCATACC
chrA2:105213265-105213279
TTGTTTTCTTGTTTCATTCCCTTAATTATT105213265AATGTTGTCAATGAAGCAGGAATTACCCAAAATGATGAGGAAAGG
chrA2:123910848-123910862
AGAGGGGTAAAAGTGATACCTCCTAAGACT123910848AATGTTGTCAATGAAGTAAATCCACGCCTATGAGAAGTTTACCTG
chrB1:78883422-78883436
TTAATATTAATATTAAATGGATGCCCACAG78883422AATGTTGTCAATGAAAATCTGTGTTTAAAGTGATAATATATTCTA
chrB2:26276581-26276595
CCTTGGTCAGTGTCCCCTCTTGCTTTTTAT26276581AATGTTGTCAATGAAGATTATTGGTATCTAAACACCACCCCACTC
chrB3:81218072-81218086
TGATCATGAAAAATTGTATTTTTCTCACAA81218072AATGTTGTCAATGAAAAGAGCACTAAAAATAGTAGATAAAGTCTG
chrC1:82651133-82651147
AGATAGAAAGAGAGAGAGAGAATGCAAATA82651133AATGTTGTCAATGAAATCACAGGCTACCAAAGGGGGGGGGAAAGG
chrC1:181252522-181252536
AGTTCTTAAGTGGCAGTAACGCCATGATAA181252522AATGTTGTCAATGAACATTTCTTCATCACTCTTGATATTCTATGT
chrD1:87858373-87858387
TGACAATGTGTCACTTTAGAGATTATCATT87858373AATGTTGTCAATGAAAAGCCATTTCTCATCATCCTTATGCCAGTT
chrD2:767157-767171
CAGGGCTTGCAACTGTCATGCTCTGAAAAC767157AATGTTGTCAATGAATCAATCTCATGGCTTCTCTTTTTAGCTGTA
chrF1:59267211-59267225
GGAATGTGTATGACAGAGAGAGAATTTCAA59267211AATGTTGTCAATGAAGGGCGCCTGGGTGGCTGAGTCGGCTAAGCA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/felCat8/TTCATTGACAACATT
lang : en | db : felCat8 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.078 | 0.071 | search_plus_done; http://172.18.8.78:28754/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.082 | 0.005 | search_minus_done; http://172.18.8.78:28754/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=49
0.085 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).