GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-04-15 20:20:25, GGGenome : Fugu genome, FUGU5/fr3 (Oct, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr6:1730650-1730664
GATTTAAAAATATATATATTTATTTTTTAC1730650TTCATTGACAACATTGTCTTAGTTGTGACTGATTAATACTATGAT
chr10:2982838-2982852
TATATTTTTATAATACAGATTATAATTCTT2982838TTCATTGACAACATTTCATTTTCTATTCAAAGTGGATTTTTTCAC
chr13:2078246-2078260
GTACAAATATTCATAAGGATAGCCCATTTC2078246TTCATTGACAACATTTGGTTTAAGGGGAAAATAATTTTACTACAA
chr22:11291069-11291083
TGCCACTGTTCTTTTACTGGACCACTGCAG11291069TTCATTGACAACATTAAATATCCCATACATGATTTAAAGACTATT
HE591887:108500-108514
ACCTCTCACTCGCCACACTAGTTAAGTTTT108500TTCATTGACAACATTGATTTCCAAGCCATCCGAATTTTTGTTTGT
HE595325:5479-5493
ACAAACAAAAATTCGGATGGCTTGGAAATC5479AATGTTGTCAATGAAAAAACTTAACTAGTGTGGCGAGTGAGAGGT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/fr3/TTCATTGACAACATT
lang : en | db : fr3 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.076 | 0.069 | search_plus_done; http://172.18.8.76:28075/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.080 | 0.004 | search_minus_done; http://172.18.8.76:28075/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=45
0.080 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).