GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-03-08 05:13:44, GGGenome : Fragaria vesca genome, v2.0.a1 (Dec, 2014)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Fvb6:6937296-6937310
GTCGTCTTACTTGGGACAGCCGCTTCCATT6937296TTCATTGACAACATTGATCTGGATCGAGGTTCTGGTGATCGGCTA
Fvb2:20022789-20022803
GATTTGGACATGGGGAAGGCCAGGAATTCT20022789AATGTTGTCAATGAACAGCATGACCATTCACCATCACTTGGAATG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/fragaria_vesca_v2.0.a1/TTCATTGACAACATT
lang : en | db : fragaria_vesca_v2.0.a1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.199 | 0.192 | search_plus_done; http://172.18.8.72:28272/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.204 | 0.005 | search_minus_done; http://172.18.8.72:28272/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=49
0.205 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).