GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-12-08 11:31:33, GGGenome : Malayan flying lemur genome, G_variegatus-3.0.2/galVar1 (Jun, 2014)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

NW_007729851v1:210569-210583
TTTCTTAGAGAAGTAGCCTGACTAAAGCAT210569TTCATTGACAACATTTTAAAGCATAGGAGTTTATTTCACTTTCAG
NW_007731805v1:137230-137244
AAGTTAAATTTTTATTTTTCTTATTTTGTT137230TTCATTGACAACATTCCAGATTGAGTTTTAGGTAAATGCTTCTTG
NW_007732124v1:102603-102617
TAAAACTTCTGATTTTGTGCAATATTCCCT102603TTCATTGACAACATTAAACAGTAATTAAATATTTGCTAAGTGGCT
NW_007734946v1:15693-15707
GTTTACTTATAAGGGGGTTTTATAGAAAGT15693TTCATTGACAACATTGCATTTGAGATTCTTTAGGAATGAGTAGGA
NW_007726214v1:376576-376590
GAAATTGAGGAAATATCTATTAGAAAAAAC376576AATGTTGTCAATGAAGGTGATTACGTTTTGGGTAGAAACCTCTAT
NW_007726555v1:104064-104078
TTAATATTAATATTAAATGGATGCCCACAA104064AATGTTGTCAATGAAAATCTGTGTTTAAAGTGATAATATATTCTG
NW_007726589v1:273034-273048
TTCTTCCTCTAAAATCTGTTAGGCTCTAGA273034AATGTTGTCAATGAAAATTTGAATGCCACTCTAGAAATACTTTCA
NW_007726591v1:199027-199041
GGGTGGCATTATGCACAGGTAAAAACAGAG199027AATGTTGTCAATGAAAGGATGAAGAGAATGGATATGGCAATCTAC
NW_007728297v1:243668-243682
GAGGGCTTTTCCAGCTCCAAGGTCAATGGG243668AATGTTGTCAATGAAAGGTCCACAGGCCACTGCACTGTGCTTACC
NW_007728414v1:226126-226140
AATGCGTTTTCATATGCATATGTAATAGTA226126AATGTTGTCAATGAAAACACAATAGTATTTGGAGTGCAGCATACT
NW_007729681v1:14026-14040
GAGAAACTGAGCTTTCAGTTGCTTTTGACT14026AATGTTGTCAATGAAGAGGTGGAGCTCTTAATAGAGATGACAAGG
NW_007730213v1:109831-109845
ATTCTCAAATGGAGGGAATTGACAACAGCA109831AATGTTGTCAATGAATGTGCAGACAGCAACGACAGGCAACTATTT
NW_007730343v1:50322-50336
CCTTGAAGTCAGTCTTAGGCCATGTGCCTA50322AATGTTGTCAATGAACCAGAGCAGAAGGACTGAGGTAGTTGAGAG
NW_007730409v1:152721-152735
AAATGACAGCATCCAGGTACAGGAATCTTA152721AATGTTGTCAATGAAATTCAATCCAGGGAGGAACAACCCAAGGCA
NW_007730409v1:153289-153303
AAATGACAGCATCCAGGTACAGGAATCTTA153289AATGTTGTCAATGAAATTCAATCCAAGGAGGAACAACCCAAGGCA
NW_007734683v1:81580-81594
AGAAAAAAACCATTGCTGGTTTTACTTTAA81580AATGTTGTCAATGAAACAGTTAACAGGATTAATATTGTTAAATCA
NW_007734891v1:54113-54127
CACACACACACACACAACCAGGGGCCTTAC54113AATGTTGTCAATGAATCTAGAACTGCTCTTTGCCTCCAGGCCCAG
NW_007742154v1:12166-12180
ATTTCAATTCTGTCTAAGGACTCCTATGTT12166AATGTTGTCAATGAAGAAAATGACAGAACATTGTGAAATAAACAA
NW_007807908v1:845-859
CAAGAAGCATTTACCTAAAACTCAATCTGG845AATGTTGTCAATGAAAACAAAATAAGAAAAATAAAAATTTAACTT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/galVar1/TTCATTGACAACATT
lang : en | db : galVar1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.079 | 0.071 | search_plus_done; http://172.18.8.77:28765/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.085 | 0.006 | search_minus_done; http://172.18.8.77:28765/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=46
0.088 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).