GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-12-06 09:50:22, GGGenome : Gorilla genome, gorGor3.1/gorGor3 (May, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr2B:47971145-47971159
ATTGCAGCAAAGAAGCACATTTATATTCTA47971145TTCATTGACAACATTAGCATATAATGCAAATTTACTTTGGAACTT
chr3:11174163-11174177
TTTACTTTCAAAAGGTGGGGAGGGGAAGAA11174163TTCATTGACAACATTTAGAAATCAGGAGATTTCATGTGGAAAAAA
chr3:15683215-15683229
ATTGTAATAGCCAGAAATTGGAAACATATA15683215TTCATTGACAACATTTAAGATTATAATATAGTCATATAATAGTCC
chr3:86654290-86654304
TTGATTTTGTATATATTAAATAGTTGAAAC86654290TTCATTGACAACATTAAATTTGTTTTCTAGGCTCTATTGGGGTAA
chr4:16107181-16107195
AACGAAAGGCGTTTGAGGAAAGCCTGATAA16107181TTCATTGACAACATTACCATCAGCCACACCTTATCATTCCTAGCA
chr4:70444766-70444780
TCTTCAAATATTTTACAGAGTTCAACTCTT70444766TTCATTGACAACATTATGACATTATGCTGATTGGATCCAGTGAGT
chr4:159123385-159123399
CAGAATATATTATCGCTTTAAACACAGATT159123385TTCATTGACAACATTTTGTGGGCACCCATTTAATATTAATATTAA
chr4:176295184-176295198
AAAAACCTCTGATTTTGTGTAACACTTCTT176295184TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGATTACAT
chr4:192180537-192180551
TTTGGACCCCCAAATCAGTCTTCATATTCT192180537TTCATTGACAACATTCATTAAGTTCTGCAGAAATTAAATAGAATT
chr6:61461355-61461369
CTATTTCAATCAACCATCTTGTAATCATAC61461355TTCATTGACAACATTTTACTCATACTATAATAAGTTGCTATTTCT
chr7:3498899-3498913
GTGGTGCCTGGCCTGAGTCAGCACGTTAGC3498899TTCATTGACAACATTGGTTCGTTCAACAAATATTGCCTGAGAAGA
chr8:31567424-31567438
ATATTTTTTAATTCATCGATATTTCCACTT31567424TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
chr11:24831963-24831977
TTGAGTTTCCTGGAACATAGATATGTCTTG24831963TTCATTGACAACATTCTAGCATTGAGGACAGTGAATAGAGCAAAG
chr13:67067452-67067466
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA67067452TTCATTGACAACATTGCCTGAGGTAACTCACACTGAGGTGACAAC
chr18:26747508-26747522
ATATTTATATATGTATATATTTCATATCAT26747508TTCATTGACAACATTTACTTGGGAGATTTGTCTCAACAAAAATTA
chr2B:84540806-84540820
AATGCCCCACATTTCATTAAGGGTGATGAC84540806AATGTTGTCAATGAAGAAGTTGCTTCTCATATAACTATACTGTCA
chr3:58699696-58699710
GCCTGTTTTTCATATGCATATGTAATAGGG58699696AATGTTGTCAATGAAAACACAATAGTATTTGGAGTGCAGCATAGT
chr5:42743263-42743277
CCTGCAATTGGCCATCTAGTGTGACAAGGC42743263AATGTTGTCAATGAAATGTGGGTATAATCTAGCTTGTCTCACTTC
chr7:75771350-75771364
AACTAACACCCATAAAAGGTATGACTCTTT75771350AATGTTGTCAATGAAGATTTAACATAATATTCTACAACAAATATA
chr12:77779847-77779861
ATGAGATAGGTTTGTTCCAGAAGTTTAAAA77779847AATGTTGTCAATGAATTTGATAAAGTTTAATATTCACATTAAAAG
chr19:38292190-38292204
CTCCCTTAGGAGAGCTGTTAGCATTATACT38292190AATGTTGTCAATGAAAAAGCTAAGATAGGCCAGGCATGGTGGCTC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/gorGor3/TTCATTGACAACATT
lang : en | db : gorGor3 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.087 | 0.079 | search_plus_done; http://172.18.8.78:28035/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.100 | 0.013 | search_minus_done; http://172.18.8.78:28035/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=35
0.101 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).