GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-08 07:31:42, GGGenome : Hydra genome, h7 (Aug, 2008)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

EQ246071.1 Hydra magnipapillata scf_1101284904507 genomic scaffold, whole genome shotgun sequence
position: 238508-238522
TACTGATTTCGCCAGAGTTAATAACAGGTT238508TTCATTGACAACATTTACAAAAAAAAAACTATTAATTTGTTTTTA
ABRM01002522.1 Hydra vulgaris strain 105 ctg1101284811911, whole genome shotgun sequence
position: 9505-9519
ATAAAGTAAAATTCATCTGAAAAACAAGAT9505TTCATTGACAACATTGAATTAAGTATAAATTACCACATAAATCCA
EQ255923.1 Hydra magnipapillata scf_1101284937467 genomic scaffold, whole genome shotgun sequence
position: 14152-14166
GTATGTGACCTGAAGAATTGAATTTTACCT14152TTCATTGACAACATTGAGCATTGTGGTGACATCAATTAATAGAAC
EQ258379.1 Hydra magnipapillata scf_1101284939967 genomic scaffold, whole genome shotgun sequence
position: 53314-53328
AAATGTGACCTGAAGAATAAAATTTTACCT53314TTCATTGACAACATTGAGCATTGTGGTGGCATATCATTTAATAGA
EQ260014.1 Hydra magnipapillata scf_1101284941615 genomic scaffold, whole genome shotgun sequence
position: 38537-38551
TCTACTAGAGTATCACCAAACTCAGCAACT38537TTCATTGACAACATTATTACAACTGATGTCTTCAATAATAATATA
EQ261147.1 Hydra magnipapillata scf_1101284942755 genomic scaffold, whole genome shotgun sequence
position: 53301-53315
TACTGATGAATATTATTTGGAATCATTTGT53301TTCATTGACAACATTTATGATTTAAAATTCAAGTTAGACATTTCT
EQ261616.1 Hydra magnipapillata scf_1101284943226 genomic scaffold, whole genome shotgun sequence
position: 96126-96140
ACATATTAAAGAATGCTTTATTCTCTGGTA96126TTCATTGACAACATTAAAAAAGTTTTCCTCAATTAAAAATAATGT
EQ236259.1 Hydra magnipapillata scf_1101284871475 genomic scaffold, whole genome shotgun sequence
position: 40895-40909
TCTATTAATTGATATGTCACCACGATGCTC40895AATGTTGTCAATGAAAGGTAAAATTTAATTCTTCAGGTCACATAC
ABRM01105138.1 Hydra vulgaris strain 105 ctg1101284384586, whole genome shotgun sequence
position: 1462-1476
TTCATTTAGAAAACGGTTATCATTTAAATT1462AATGTTGTCAATGAAATATTTTTTAATTCTCAATAAAATTTGGGG
EQ243899.1 Hydra magnipapillata scf_1101284895952 genomic scaffold, whole genome shotgun sequence
position: 18164-18178
TATATTATTATTGAAGACATCAGTTGTAAT18164AATGTTGTCAATGAAAGTTGCTGAGTTTGGTGATACTCTAGTAGA
EQ245275.1 Hydra magnipapillata scf_1101284901419 genomic scaffold, whole genome shotgun sequence
position: 6903-6917
TCCATTTGGAAAACGGTTATCATTTAAATT6903AATGTTGTCAATGAAAAATTTTGGAAAACTCAATAAAACTACACT
EQ250740.1 Hydra magnipapillata scf_1101284927788 genomic scaffold, whole genome shotgun sequence
position: 4086-4100
TAAAAACAAATCAATAGTTTTTTTTTTATA4086AATGTTGTCAATGAAAACCTGTTATTAACCCTGGCGAAATCAGTA
EQ251051.1 Hydra magnipapillata scf_1101284929229 genomic scaffold, whole genome shotgun sequence
position: 5503-5517
TGGATTTATGTGGTAATTTATACTTAATTC5503AATGTTGTCAATGAAATCTTGTTTTTCAGATGAATTTTACTTTAT
EQ252074.1 Hydra magnipapillata scf_1101284931008 genomic scaffold, whole genome shotgun sequence
position: 163556-163570
CTAAATTAGTTCGAGATTATCATTTAAATT163556AATGTTGTCAATGAAATATTTTTTAATTCTCAAAAAAACTACACT
EQ252499.1 Hydra magnipapillata scf_1101284931663 genomic scaffold, whole genome shotgun sequence
position: 2161-2175
AGTTGATTAAAGGATTATTTTATACAATAG2161AATGTTGTCAATGAAATAAATATATGTAACCAATTTAACAACATT
EQ253748.1 Hydra magnipapillata scf_1101284935243 genomic scaffold, whole genome shotgun sequence
position: 23890-23904
CGAGAAAAGACGTTAAAGACTGTGTGCGCA23890AATGTTGTCAATGAAGTTCAATAGATCCAGCACTAATAAAATGGG
EQ260582.1 Hydra magnipapillata scf_1101284942187 genomic scaffold, whole genome shotgun sequence
position: 3803-3817
AAGAGTTTTATTAAAGATATCGGTTGTTAT3803AATGTTGTCAATGAAGGTAGCTGAAGTTGAGGTAATAATCTTCAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/h7/TTCATTGACAACATT
lang : en | db : h7 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.072 | search_plus_done; http://172.18.8.77:28233/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.087 | 0.008 | search_minus_done; http://172.18.8.77:28233/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=43
0.093 | 0.006 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).