GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-01 12:09:18, GGGenome : Naked mole-rat genome, Broad HetGla_female_1.0/hetGla2 (Jan, 2012)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

JH602045:7548924-7548938
TGATCAGTTCAACTGACAAGCTCTAAAATC7548924TTCATTGACAACATTTCCCAGCTTGTACAAAATGACACCTGGTTT
JH602065:12958787-12958801
TAACTGTCATTACTCCACATTCAGGCAATT12958787TTCATTGACAACATTAATTTGTATATTAGCTGACAGCCTCCCAAC
JH602125:6333340-6333354
GGGTGACTAAGAAAACAAGAGATCACACAC6333340TTCATTGACAACATTGCATTATATTCTCCACCAGGAGACAATGTA
JH602190:1481603-1481617
ATGTCTATTTTAAAACAATTTTAGTTTCTT1481603TTCATTGACAACATTGCAGAAAAAACAGAATATTACTTTAGTATA
JH602046:24397826-24397840
ACATTCTCATTTATATGATGTCAGTTTTTA24397826AATGTTGTCAATGAATACATTTTTAAAGTGTGCATGAACTAAAGC
JH602062:23068220-23068234
ACTGTTAAATGTTTTTTGTTATAGAAAAAT23068220AATGTTGTCAATGAAAAAATCAGTCATCAAGTTAACTCTAATGCT
JH602064:10949398-10949412
GTATAGTGTGAAAAACTTCCTGGCCAGAAC10949398AATGTTGTCAATGAAGCCACAACTGGCTAGCTTCACCCTTATGAT
JH602068:5274903-5274917
TCAACCTGTTAGTCTGAGGAAAACAGAAGC5274903AATGTTGTCAATGAAAAGTGGATATACCCAGATAACTAAATAATA
JH602075:23249414-23249428
AATGCAGTCCTCAATTTTTTAAACTATAAA23249414AATGTTGTCAATGAAATCCTTGAGGACAGCAACTATCATTGAAAG
JH602085:4797715-4797729
AAAAGCTGAACTAGTTCAATTTGGGTAATG4797715AATGTTGTCAATGAACAATACCTTAAAGTCCAGTCTCCTTATCTT
JH602108:7902763-7902777
AATACTTCATTATTTTAAGTAGGATTATTA7902763AATGTTGTCAATGAAATAAAATGTCTTCTAAAATATAGCCAGAGT
JH602111:10424870-10424884
AGAGGCATCAGGAAGCAAACAATAATATAA10424870AATGTTGTCAATGAATACACAGAGTGAGAGGTATATAGTCTCATA
JH602139:7258508-7258522
TTTCACTAACACACAGACACACTTGTTAAA7258508AATGTTGTCAATGAAAGTGCATAAAGGGATCTTCTTAAGCCAAAC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/hetGla2/TTCATTGACAACATT
lang : en | db : hetGla2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.078 | 0.072 | search_plus_done; http://172.18.8.77:28046/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.083 | 0.005 | search_minus_done; http://172.18.8.77:28046/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=46
0.085 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).