GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-07 21:50:16, GGGenome : Human pre-spliced RNA, RefSeq curated on hg38.p12, D3G 21.01 (Jan, 2021)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

NM_001301128.2|MAGI2;9863|chr7:78017054:79453667:-|prespliced::chr7:78017054-79453667(-)
position: 731566-731580
TATATTTGTTATAGAATATTATGTTAAATC731566TTCATTGACAACATTAAAGAGTCATACCTTTTATGGGTGTTAGTT
NM_001304840.3|HECW2;57520|chr2:196194071:196362177:-|prespliced::chr2:196194071-196362177(-)
position: 149028-149042
TGACAGTATAGTTATATGAGAAGCAACTTC149028TTCATTGACAACATTGTCATCACCCTTAATGAAATGTGGGGCATT
NM_001348768.2|HECW2;57520|chr2:196194071:196593554:-|prespliced::chr2:196194071-196593554(-)
position: 380405-380419
TGACAGTATAGTTATATGAGAAGCAACTTC380405TTCATTGACAACATTGTCATCACCCTTAATGAAATGTGGGGCATT
NM_012301.4|MAGI2;9863|chr7:78017054:79453667:-|prespliced::chr7:78017054-79453667(-)
position: 731566-731580
TATATTTGTTATAGAATATTATGTTAAATC731566TTCATTGACAACATTAAAGAGTCATACCTTTTATGGGTGTTAGTT
NM_014296.3|CAPN7;23473|chr3:15206245:15252916:+|prespliced::chr3:15206245-15252916(+)
position: 42038-42052
ATTGTAATAGCCAGAAATTGGAAACATATA42038TTCATTGACAACATTTAAGATTATAATATAGTCATATAATAGTCC
NM_020760.4|HECW2;57520|chr2:196194071:196592983:-|prespliced::chr2:196194071-196592983(-)
position: 379834-379848
TGACAGTATAGTTATATGAGAAGCAACTTC379834TTCATTGACAACATTGTCATCACCCTTAATGAAATGTGGGGCATT
NM_152744.4|SDK1;221935|chr7:3301251:4269000:+|prespliced::chr7:3301251-4269000(+)
position: 222790-222804
GTGGTGCCTGGCCTGAGTCAGCTCATTAGC222790TTCATTGACAACATTGGTTCGTTCAACAAATATTGCCTGAGAAGA
NR_027112.2|LINC02112;285692|chr5:9641314:9903824:-|prespliced::chr5:9641314-9903824(-)
position: 144420-144434
CCTGGGTATAATGCACTGATCTGTTGATCT144420TTCATTGACAACATTGCCATCGACTTTGGAGCTGGAAAGGCCCTC
NR_046871.1|LINC00333;100874128|chr13:84140601:84606768:+|prespliced::chr13:84140601-84606768(+)
position: 50811-50825
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA50811TTCATTGACAACATTTCCTGAGGTAACTCACACTGAGGTGACAAC
NR_147074.1|LINC01362;103283057|chr1:82903182:83166815:+|prespliced::chr1:82903182-83166815(+)
position: 93611-93625
CTAATTAATGAATAGTAAGTATATTTTCTC93611TTCATTGACAACATTTTTCCTCTTACTTTATTGTAAGAATACAAT
NM_001080448.3|EPHA6;285220|chr3:96814593:97761532:+|prespliced::chr3:96814593-97761532(+)
position: 545885-545899
AATTTGAATATTAATTTTAAAATTTATTCA545885AATGTTGTCAATGAACATTGTCAGACATTTTGCAGCATTTCTTTA
NM_001135805.2|SYT1;6857|chr12:78863981:79452008:+|prespliced::chr12:78863981-79452008(+)
position: 243533-243547
ATAAGATAGGTTTGTTCCAGAAGTTTAAAA243533AATGTTGTCAATGAATTTGATAAAGTTTAATATTCACATTAAAAG
NM_001135806.2|SYT1;6857|chr12:79045691:79452008:+|prespliced::chr12:79045691-79452008(+)
position: 61823-61837
ATAAGATAGGTTTGTTCCAGAAGTTTAAAA61823AATGTTGTCAATGAATTTGATAAAGTTTAATATTCACATTAAAAG
NM_001291901.2|SYT1;6857|chr12:78864773:79452008:+|prespliced::chr12:78864773-79452008(+)
position: 242741-242755
ATAAGATAGGTTTGTTCCAGAAGTTTAAAA242741AATGTTGTCAATGAATTTGATAAAGTTTAATATTCACATTAAAAG
NM_001350622.1|KHDRBS2;202559|chr6:61679959:62286227:-|prespliced::chr6:61679959-62286227(-)
position: 287903-287917
AGAAATAGCAACTTATTATAGTATGAGTAA287903AATGTTGTCAATGAAGTATGATTACAAGATGGTTGATTGAAATAG
NM_001365308.1|BMPER;168667|chr7:33905538:34156427:+|prespliced::chr7:33905538-34156427(+)
position: 213411-213425
TCTACAGATTTTGGATTTACCAGCCCCCAC213411AATGTTGTCAATGAATTCCTTAAAATCTCTCTCTCTCTCTCTCTC
NM_002897.5|RBMS1;5937|chr2:160272150:160493807:-|prespliced::chr2:160272150-160493807(-)
position: 127190-127204
AAGTTCCAAAGTAAATTTGCATTATATGCT127190AATGTTGTCAATGAATAGAATATAAATGTGCTTCTTTGCTGCAAT
NM_005639.3|SYT1;6857|chr12:78864773:79452008:+|prespliced::chr12:78864773-79452008(+)
position: 242741-242755
ATAAGATAGGTTTGTTCCAGAAGTTTAAAA242741AATGTTGTCAATGAATTTGATAAAGTTTAATATTCACATTAAAAG
NM_016836.4|RBMS1;5937|chr2:160272150:160493807:-|prespliced::chr2:160272150-160493807(-)
position: 127190-127204
AAGTTCCAAAGTAAATTTGCATTATATGCT127190AATGTTGTCAATGAATAGAATATAAATGTGCTTCTTTGCTGCAAT
NM_133468.5|BMPER;168667|chr7:33904914:34156427:+|prespliced::chr7:33904914-34156427(+)
position: 214035-214049
TCTACAGATTTTGGATTTACCAGCCCCCAC214035AATGTTGTCAATGAATTCCTTAAAATCTCTCTCTCTCTCTCTCTC
NM_152688.4|KHDRBS2;202559|chr6:61679960:62286225:-|prespliced::chr6:61679960-62286225(-)
position: 287901-287915
AGAAATAGCAACTTATTATAGTATGAGTAA287901AATGTTGTCAATGAAGTATGATTACAAGATGGTTGATTGAAATAG
NR_040249.1|CYP2G1P;22952|chr19:40890825:40900508:+|prespliced::chr19:40890825-40900508(+)
position: 1462-1476
CTCCCTTAGGAGAGCTGTTAACATTATACT1462AATGTTGTCAATGAAAAAGCTAAGATAGGCCAGGCATGGTGGCTC
NR_146870.1|KHDRBS2;202559|chr6:61542696:62286227:-|prespliced::chr6:61542696-62286227(-)
position: 287903-287917
AGAAATAGCAACTTATTATAGTATGAGTAA287903AATGTTGTCAATGAAGTATGATTACAAGATGGTTGATTGAAATAG
NR_146871.2|KHDRBS2;202559|chr6:61630252:62286225:-|prespliced::chr6:61630252-62286225(-)
position: 287901-287915
AGAAATAGCAACTTATTATAGTATGAGTAA287901AATGTTGTCAATGAAGTATGATTACAAGATGGTTGATTGAAATAG
NR_146872.1|KHDRBS2;202559|chr6:61679959:62286227:-|prespliced::chr6:61679959-62286227(-)
position: 287903-287917
AGAAATAGCAACTTATTATAGTATGAGTAA287903AATGTTGTCAATGAAGTATGATTACAAGATGGTTGATTGAAATAG
NR_146873.2|KHDRBS2;202559|chr6:61630252:62286225:-|prespliced::chr6:61630252-62286225(-)
position: 287901-287915
AGAAATAGCAACTTATTATAGTATGAGTAA287901AATGTTGTCAATGAAGTATGATTACAAGATGGTTGATTGAAATAG
NR_146874.2|KHDRBS2;202559|chr6:61630252:62286225:-|prespliced::chr6:61630252-62286225(-)
position: 287901-287915
AGAAATAGCAACTTATTATAGTATGAGTAA287901AATGTTGTCAATGAAGTATGATTACAAGATGGTTGATTGAAATAG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/hg38_RefSeqCurated_prespliced_d3g2101/TTCATTGACAACATT
lang : en | db : hg38_RefSeqCurated_prespliced_d3g2101 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.077 | 0.069 | search_plus_done; http://172.18.8.75:28856/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.087 | 0.011 | search_minus_done; http://172.18.8.75:28856/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=40
0.098 | 0.011 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).